| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGCCCGGGACGCACAUGUGCGCGCGACGCCCGGCAGCUGCCACCGCGGG… | 1106 nt | 0.7116 |
Enables DNA-binding transcription activator activity, RNA polymerase II-specific and bHLH transcription factor binding activity. Contributes to E-box binding activity. Involved in positive regulation of transcription by RNA polymerase II. Located in nucleus. Part of transcription regulator complex. [provided by Alliance of Genome Resources, Jul 2025]
A study in human corpus cavernosum tissue identified the SCX as a gene marker expressed in the FB4 fibroblast subcluster, contributing to a tenogenic signature [Zhao et al. DOI:10.1038/s41467-022-31950-9].