Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGGGCGCUGCACACUCGCGCCCGAGGACUGCCUGCCCCCCUUCAGCC… | 3335 nt | 0.6030 | |
| AGUUUUUGCAACGGCUAAGGAAGGGCCUGUGGGUUUAUUAUAAGGCGGA… | 3165 nt | 0.5912 |
Summary
The protein encoded by this gene is a transmembrane (type I) heparan sulfate proteoglycan and is a member of the syndecan proteoglycan family. The syndecans mediate cell binding, cell signaling, and cytoskeletal organization and syndecan receptors are required for internalization of the HIV-1 tat protein. The syndecan-1 protein functions as an integral membrane protein and participates in cell proliferation, cell migration and cell-matrix interactions via its receptor for extracellular matrix proteins. Altered syndecan-1 expression has been detected in several different tumor types. While several transcript variants may exist for this gene, the full-length natures of only two have been described to date. These two represent the major variants of this gene and encode the same protein. [provided by RefSeq, Jul 2008]
Forensic Context
A study in rats demonstrated that the SDC1 mRNA expression showed bimodal peaks at 4 and 20 hours following experimental fat embolization via triolein injection or femoral fracture, with the initial peak linked to physical endothelial glycocalyx damage and the subsequent peak associated with inflammatory cytokine secretion [Kuwata et al. DOI:10.1016/J.Legalmed.2024.102531]. In a separate rat model of mild traumatic brain injury, the SDC1 gene was highly expressed within the first 12 hours post-trauma before being down-regulated, implicating it in the tissue regeneration response to injury [Colak et al. DOI:10.1016/j.injury.2012.01.021]. In a separate forensic investigation using a Sprague-Dawley rat model of fat embolism, the SDC1 mRNA exhibited bimodal expression peaks at 4 and 20 hours post-injury, with the initial peak linked to physical damage of the endothelial glycocalyx and the subsequent peak associated with biochemical inflammatory reactions, suggesting its role in lung damage during fat embolism progression [Kuwata DOI:10.1016/J.Legalmed.2024.102531].