Basic Information

Symbol
SDC2
RNA class
mRNA
Alias
Syndecan 2 Fibroglycan SYND2 CD362 HSPG1 HSPG Heparan Sulfate Proteoglycan 1, Cell Surface-Associated Heparan Sulfate Proteoglycan Core Protein Syndecan Proteoglycan 2 Syndecan-2 Cell Surface-Associated Heparan Sulfate Proteoglycan 1 CD362 Antigen
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_002998.4
Sequence length
3307.0 nt
GC content
0.4155

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-935.10 kcal/mol
Thermodynamic ensemble
Free energy: -999.95 kcal/mol
Frequency: 0.0000
Diversity: 947.85
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((...(((((((((.((((((((...)))))(((((((((((..................((((((((.(((((((....((.(((....)))))............(((.(((((((((((((...((.(((((.(((((.((.........((...)).......((((....)))).))))))))))).).))...))))))))))).)).)))...........)))))))(((((.((....)).)))))))))))))))))))))))).(((((((((((.(((.(((((.(((.((((((((((.((((((((((..((((..((((((((.....)))))..))).)))).))))))).).)).))((((((.((.(((((((.((((..(((........)))....))))...)))).))).)).))))))(((.....((((.((((((...))))))..))))....)))..)))))))).))))).)))...(((((((..(((((..(((..((((.(.(((((((((((((.......((.(((((((.....(((.((...(((((((((...(((((....)))))..))))))))))).)))......))))))).))((((...(((.((((..((((.(.((.....(((((....((....))....)))))....))).)))).((((((..((((((...(((((....(((((((((......((((...(((...)))..(((((((((.((.(((((((((((((..(((.((((...)))).))).............((.....))(((((....))))).(((((.....)))))...((((((....))))))..((.(((.(.((((.......)))).)))).))...)))))))))))))))..((((((((((((.((.((.((((...)))).))..)).)))))).))))))........((((((.(((((.....(((((((.(((((......)))))..))))..)))......)))))....)))))).((((((((((.......)))).)))))).......(((((((((.((((.(((......))))))).)))))))))......(((((((((.((((...)))).))))))))).....................((((...)))).)))))))))............................))))))))))))).....)))))(((........)))((((((...........))))))....))))))..)))))).................)))).)))...)))).((((.((..(((((((....))))))))).)))))))))))).((((((((........))))))))............))))).).))))..))).)))))))))))).))))))))))))))...........(((((.(.(((..((((((((...((((.((.(((((((((((....(((((.....(((((.(((((.(((................((((((((((....(((.(((.((.............((((((((((((((((((((((.(((((.......((.....)).......)))))(((((((....)))))))...)))))))).)))))(((.((((..........)))).)))........((((((((((((....))))))))))))...)))..))))))(((((((((((.....((((((.......))))))......))))))((((((((((((((((.((((.............))))......((((((...((((((((((((((.......((((.....((((((......))))))....))))...))))))))))))))..))))))............((((.((((((.(((.((....)).)))...))))))))))......((((((((.((((....................)))).))))))))...(((((((..((((((((...........(((((((((.....(((((((.....))).)))).........((((((((.((.............))))))))))((((((((.(((.(((((.....((..((....))..))......))).)).))).)))))))).....))))))).))))))))))..)).)))))....((((..(((.....))).)))).....((((......))))...)))))))))).)))))).........(((...((((.(((....))).)))).)))))))))).))))))....)))))))))).(((....)))......((((.((((((((.((.((.(.(((((....)))......(((((....)))))((((.........)))))).))).)).)))))))).))))..((((....))))))).))))).)))))((((((.......))))))......)))))......))))))).....)))))).))))...))))).)))....))).)...))))).)))..))).)))))).))))).....((.((.(((((.(.((((((((.(((.(((.(((..((((((......(((((((((((((.(((...(((((((((......)))))))))...)))...))))))))))))))))))).)))))).))).))))))))).))))))).))...(((((..(((((..((.......))...)))))....(((((((((((((((......((((((..((((.((((((.(.((.(((.((((((((((((.........(((((((((((.(((((((.....))))))).))))))...)))))........)))).......))))).)))(((((((((((..................(((((....))))).....(((..((.(((((...((((....))))...))))))).)))........).))))))))))((((((.(((............(((((..((..((((........))))..)).)))))))).))))))..((((((((........))))))))(((((((((((.((....))...)))))))))))..))).)).))))))).))))...)))))).))))))))...)))))))...))))).
Thermodynamic Ensemble Prediction
.((((..((((({(,((((((((((((...|})))(((((((((((.................,((((((((.(((((({....,{.{{,....,}},,............(((.(((((((((((((...((.{((((.(((((.((.........{{...||.......|||{....}})).))))))))))).}.))...))))))))))).)).)))...........)))))))(((((.((....)).)))))))))))))))))))))))).(((((((((((,(((.((({(,(((.((((((((((.(({(((((((..((((..((((((((.....))))),.))).)))).))))))).).}),})((((((.((.(((((((,(((((,{({....,,,,)))},,,|||}...})))}})).)).)))))){{{....,{({{.{{{{((,,,))))))..)))),,.,)))..)))))))).)))}}})}),},(((((((..(((((..(((..((((.(.(((((((((((((.......((.(((((((...{.{({.(,..((((((((((...,((((....)))))..)))))))))),.}))..,,..))))))).))((((...(((.((((..({({{(.{,,||,}||{{{....{{,..,|},,.||}}},.,,}|||,||,|.{{{{((,,{{{(({,..(((((..,.(((((((((......((((...(((...})}..(((((((({.((.((((((((((({{,,(((.((((...)))).)))....{{{.,,,,,{{.....|,(((({....))))).{((((.....))))|,,,({((((,...,}||||..,,,|||.|,||||,,,,...)))),}))},}}..,})))))))))))}}}..{(((((((((((.((.((.((((...)))).))..)).))))))}}))))},,.,,...,(((({.{{{{{.....||||(((.(((({......}))))..,}}}..|||{{{{{,,}}}),,,,))))},.((((((((((.......)))).)))))).......{((((((((.((((.(((......))))))).)))))))))..,,,.(((((((((.((({...}))).)))))))))..,........,,,.......{{{{...}}}}.,}))))))).........,,.,.......,.......))))))))))))).,},,)})))|{,........}}}|||{{,......,.,},}))}))},,.)))))}..}})))}..},},,..........)))).)))...)))).((((.{{.,(((((((....))))))))}.)))))))))))),{({,,((({.......,,,)))),...,.,,.....))))).}.))))..))).)))))))))))),)))}})))))))))...........(((((...(((,,((((((((...{(((.({{{{,((((((((,,..(((((,,,.,(((({.{((((.((({{{(,,....,,.,},|||{{{{{{{....{{(,{({.{{..........,||{{{,{{{,,(((((((((((((.(((({.......{{.....}}.......)))))(((((((....)))))))...)))))))),}))))..,.{{||,......|},||||,|,,.,,,....((((((((((((....)))))))))))),,,||,,,|||}}|{{{{{((({{{.....{(({{(,,..,{{||}}}}.....,})))))((((((((((((((((.{{{,.,,{,........}}}||,,.{,{(((((...((((((((((((((.......((((.....((((((......))))))....))))...))))))))))))))..))))))}.}},,,{{{{{,,((((,,((({((,{(({{{{,},||}...||||||||{,......,{{{{{{{.{{{(,,,,,,{.,,,,,....,,.}}}),}}}}}))),|.|{|||||,,|,|(((({....,,{,,,{((((,.,,,.....(((((((.....))).))))}}}}},},||,,.}}}))}})))))}}.....{((((((({......|)))))))}...,,...,.|,}}||}.},))}}))...}}}),,.,)})))|}|||||||,...|||{|.,,}}}|,{{||,...,,,,)))),...{{{{,.{{{.....))).))}}.....((((......))))...))))))))))}}})))).........{((,,,({({,(((.,,,|}}.}))),}||}}}}}}},}}}))},.,.}}}}})}))}.(((....)))......{{{(,((({{{{(.({,((.{.{||((....))}......{{{{{....))))),|||,,..,,,,,},,}))|))),)),}})))))}.)))),,{(((....))))})),))}}).}}))){(((((.......)))))}.,,...})))),.},..))))))}.,.,}),,.)).)))}..}))))).)}).,,,))))},,,)))))||((((.((((((((.,{{......}},)))))))).))))}}..,},},...}}))))))).{(((.,{{{{{{(((((((((((((.(((...(((((((((,.....)))))))))...)))...)))))))))))))..,,,,..,,|,...,,{{{{{|,.,{{|||,|,..||...|||}|..,||}}},|{.......}}..,}}}},............((((((....)))))),(({,.{{{{{..,||}|},.,|||.{{{(((((({{{..,,,....,{{{(((((((.(((((((.....))))))).)))))))...}|||....,,,.}))}.......}}))).))){(((((((((,.{({{{{...{,......||,,|...}))))).....{((..{{.(((((.,.((((....)))).,.)))))}).)}}........}.))))))))))|||}}}.|)}}}.{((.(((...))).))},..{(((........)))).....}}.)))))..))))..{((((((((........))))))))}..(((((((,{(({..,,|..|}}},,.,,})}},...)))).))))))).,(((.(((((({.,...,.......,})))).))),))).

Transcripts

ID Sequence Length GC content
AGAUACCCCCGGAGCUCCAGCCGCGCGGAUCGCGCGCUCCCGCCGCUCU… 3307 nt 0.4155
Summary

The protein encoded by this gene is a transmembrane (type I) heparan sulfate proteoglycan and is a member of the syndecan proteoglycan family. The syndecans mediate cell binding, cell signaling, and cytoskeletal organization and syndecan receptors are required for internalization of the HIV-1 tat protein. The syndecan-2 protein functions as an integral membrane protein and participates in cell proliferation, cell migration and cell-matrix interactions via its receptor for extracellular matrix proteins. Altered syndecan-2 expression has been detected in several different tumor types. [provided by RefSeq, Jul 2008]

Forensic Context

A study in rats demonstrated that the SDC2 (syndecan 2) is a potential RNA marker for methamphetamine reward and addiction, identified through transcriptome profiling of whisker follicles from a self-administration model [Song et al. DOI:10.1038/s41598-018-29772-1]. Its expression was up-down regulated, showing a 1.77-fold increase after methamphetamine self-administration and a decrease to 0.67-fold after a 30-day withdrawal session, and it was prioritized as a potential regulator based on network topological analysis with a betweenness centrality score of 0.0250.