| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAUACCCCCGGAGCUCCAGCCGCGCGGAUCGCGCGCUCCCGCCGCUCU… | 3307 nt | 0.4155 |
The protein encoded by this gene is a transmembrane (type I) heparan sulfate proteoglycan and is a member of the syndecan proteoglycan family. The syndecans mediate cell binding, cell signaling, and cytoskeletal organization and syndecan receptors are required for internalization of the HIV-1 tat protein. The syndecan-2 protein functions as an integral membrane protein and participates in cell proliferation, cell migration and cell-matrix interactions via its receptor for extracellular matrix proteins. Altered syndecan-2 expression has been detected in several different tumor types. [provided by RefSeq, Jul 2008]
A study in rats demonstrated that the SDC2 (syndecan 2) is a potential RNA marker for methamphetamine reward and addiction, identified through transcriptome profiling of whisker follicles from a self-administration model [Song et al. DOI:10.1038/s41598-018-29772-1]. Its expression was up-down regulated, showing a 1.77-fold increase after methamphetamine self-administration and a decrease to 0.67-fold after a 30-day withdrawal session, and it was prioritized as a potential regulator based on network topological analysis with a betweenness centrality score of 0.0250.