Basic Information

Symbol
SDC4
RNA class
mRNA
Alias
Syndecan 4 Amphiglycan SYND4 Syndecan 4 (Amphiglycan, Ryudocan) Syndecan Proteoglycan 4 Ryudocan Core Protein Syndecan-4 Ryudocan Ryudocan Amphiglycan
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_002999.4
Sequence length
2613.0 nt
GC content
0.4879

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-908.20 kcal/mol
Thermodynamic ensemble
Free energy: -960.84 kcal/mol
Frequency: 0.0000
Diversity: 559.22
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((((((..(((((.......(((.(.((((.((....))..))))..).)))..))))).)))))....(((((..(((((((((.(((((((.((((.(((..((((((((((((.......((.(((......)))))(((.(((.(((((.(((((((((..(.....)..))..)))))))))))).))).)))))))))))))(((((....)))))...)).))))))))))))))..)))))).......))).))))).............(((((((.(((...........(((((((((((..(((..((((......)))).)))(((((.((((((((((.((.(..(((((((.((.....)).))))))))))...(((((..(((((((.(((((((.(..(((((((....((..(((.((.((((((.((...(((((((......)))))))....)).)))))))).))))))))))))))))))))..)))))))..)))))...(((((.((.((((((.....)))).)).)).)))))(((((((.(...(((..((((((((.(((((.(((((.(((((..(((((((((.(...((((((..(((((..((((..((((...((((..((....(((((((.((((((...(((..(..(((((((.(((((..((((.((((.((((((.....(((((.(((((((((((((((((((((((.....(((..........(((.((((((...))).))).)))((((((((((..(..((.(((((...)).)))))..).))))))))))...(((((((......(((((....)))))..((((((((..(((.....))).....))))))))..))))))).......((((.((((...(((..((((((..(((((..((((((.(((....)))))))))...)))))..)))))))))...)))).))))((((((((((((..(((((((((.(((((.........(((......))))))))..))))))))).))).....(((..(.((((..(((....)))......)))).)..))).....((((((((....))))))))........((((((......)))))).((((((((.....((.......))....))))))))))))))))).)))....))))))).)))...)))))))((((((((((((((...))))))))))))))...((.(..((..((((.....))).)..))..)))....((((.((((....((((((....)).))))((((((((((.(((((.(........))))))..)))))))))))))))))))))))).)))))....(((((((.((((((((((((.........)))))))))))))))))))(((((((.((((......)))).)))))))...............(((((((......))))))))))))))))).))))..........))))))))))))..)..)))))))))..........((((.....)))))))))))..))..))))...))))......)))).)))))((.(((.((((.((((..((......)).)))).)))).))).))(((((..............)))))((.((((((..(((((.((((....)))))))))....)))))).))....(((((((((((((........))))))))).))))....))))))....((((((........))))))).)))).))).).)..))))).))))).)))))((((....)))).....)))))))).)))...).)))))))...((((.((.((((((..((((((((.((......))..)))))))))))))).)).)))).))))).))))).))))))))))).))))).....(((..(((((.(((((((((((...((((.((((((((.....(((((((((.....((((......))))................((((...))))....(((((((((((((((..((((((((((...)))))).)))))))).)).((.((.((((((.....)))))))).)).))))))))).......))))))))).....))))))...))))))..((((.(((....)))))))....((((((((((((......((.((((.((.((((((((((((((((((((((((.((((((((((((.(((....))))))))).((((((((.......(((((((..(.....)..)))).)))((.(((.((((((((((((........))))))))))))))).)))))))))).....))).)))..)))))...))))))))))))...))).)))).)).))))))....)))))))))))).)))))))))))...)))))..)))))).)))))))........((((((((.(((.(((......))).)))..))))))))......)))..........
Thermodynamic Ensemble Prediction
....((((,,(((((((.,.......((({..((((,((.,.(({....)),.},},}..})))),))})),).....)))))))((((((.(((((((,{(((.{((..{{((((((((((......,((.{{{},,.|,|}}}}{{{.|||,{((((.(((((((((..(.....)..))..)))))))))))}.})).}})}))))))))}(((((....))))).,,}}.))))))))))))))..)))))).,{..||||...{{{||,|.{||......(((((((.((({.........,((((((((((({,(((..((((......)))).))){((((.((((((((((,((,{..{(((((,.((.....)}.,)))))||||,..{{(((,.(({((((,{(((((,.{,,((((({{.,,(((.{((...|,|{||||,{{.,,|||||{|......))})})),,}.)).}))))}...})))))))}})),))))})})})),}}))..)))))...(((((.((.((((((.....))))},).)).)))))(((((((.({{.((,,.((((((((.(((((.(((((.(((((..(((((((((.{,..{{({({,.(((((..((((..((((...((((..((....(((((((.((((((...(((..(..(((((((.(((((..((((.((((.((((((......(((((((....})))))}((((((((((..,,.(({..,,.,,.,}||||{(({{(...})))|||,...((((((((((..{..{{{(((({...}),}))))..).))))))))))...||||{{{..{{{,{((({....)))))}}},,{{(({,{((({,..,{{{{{{,,|,,,))))}})))}}},}})))..{(((.((((...(((..((((((..(((((..((({(({(((....)))))))))...)))))..)))))))))...)))).)))}(((((((((,((,,(((((((((.(((((.....,{..{{......}),,)))))..))))))))).}},....||||..,.{{,..,(((.,,{|||{{{..,|({{.{..,.}}}).,|,|||||}}}},))})})))........((((((......)))))).((((((((.....((.......}}....))))))))))))))))),})}.|,.))))))).))}...{((((((((((((((((((((...))))))))))))))))))))))..,.,|{{{.....}}),,.,|,..{{,..{.((((((.......))))))}.}}|||.|,|((((((((((,{((((,(....}},.}})))),,)}})))))))||..,}))|||||..,.}}},...(((((((.((((((((((((.........})))))))))),)))))))|((((((.((({......)))).))))}},...............(((((((......))))))))))))))))).))))..........))))))))))))..)..))))))))).,,,......,,,{.,,..,},,)))))))..))..))))...))))......)))).)))))|,,,,,.,,,,.,{{{.,({,.,{{{,|.,}},.},)},},)})}{((((..............))))){{,{(((((..{((({.{(((....})))}}))),.,,)))}}}.}}....{{({{((((((((........))))))))).})))|,,,)})}}}.,,,|(((((........)))))},,)))).))).}.}..})))).))))).)))))((((....)))).....)))))))).),)}.})})))))))...{(((.((.((((((..((((((((.((,...,,)}..)))))))))))))).)).)))}.))))).))))).))))))))))),,))))....,{((..(((((.(((((((((((..,((((,(,((((((.....(((((((((.....((((......))))................{{,,...,,,,...{(((((((({((((((..((((((((({...}))))).)))))))).)).{{.((.((((((.....)))))))).}}.})))))))),}.....))))))))).....)))))).}}}})))){,((((.(((....))))))).},.|(((((((((({,.((((((.{(({.((.((((((((((((((((((((((((.((((((((((((.(((....))))))))).((((((((,....,,(((((((..(.....)..)))).)))||,(((.((((((((((((........))))))))))))))).)))))))))).....))).)))..)))))...))))))))))))}..})).)))).)).})))))).,.))))))))))}}.)))))))))))...)))))..)))))).)))))))........((((((((.{{{..{(......}}}.}}}..)))))))).....}))},,,,......

Transcripts

ID Sequence Length GC content
ACUCGCCGCAGCCUGCGCGCCUUCUCCAGUCCGCGGUGCCAUGGCCCCC… 2613 nt 0.4879
Summary

The protein encoded by this gene is a transmembrane (type I) heparan sulfate proteoglycan that functions as a receptor in intracellular signaling. The encoded protein is found as a homodimer and is a member of the syndecan proteoglycan family. This gene is found on chromosome 20, while a pseudogene has been found on chromosome 22. [provided by RefSeq, Jul 2008]

Forensic Context

A study in Wistar rats demonstrated that the expression of the SDC4 gene in the iliopsoas muscle was significantly increased only by severe hypothermia (rectal temperature 12°C) and not by milder states or cold exposure alone, identifying it as a potential diagnostic marker for fatal hypothermia [Umehara et al. DOI:10.1007/s00414-018-1888-3]. Another study in a rat model of fat embolism investigated temporal mRNA changes in glycocalyx components, noting that other syndecan subtypes, including the SDC4, were not examined in that specific experimental context [Kuwata et al. DOI:10.1016/J.Legalmed.2024.102531].