Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCGCCGCAGCCUGCGCGCCUUCUCCAGUCCGCGGUGCCAUGGCCCCC… | 2613 nt | 0.4879 |
Summary
The protein encoded by this gene is a transmembrane (type I) heparan sulfate proteoglycan that functions as a receptor in intracellular signaling. The encoded protein is found as a homodimer and is a member of the syndecan proteoglycan family. This gene is found on chromosome 20, while a pseudogene has been found on chromosome 22. [provided by RefSeq, Jul 2008]
Forensic Context
A study in Wistar rats demonstrated that the expression of the SDC4 gene in the iliopsoas muscle was significantly increased only by severe hypothermia (rectal temperature 12°C) and not by milder states or cold exposure alone, identifying it as a potential diagnostic marker for fatal hypothermia [Umehara et al. DOI:10.1007/s00414-018-1888-3]. Another study in a rat model of fat embolism investigated temporal mRNA changes in glycocalyx components, noting that other syndecan subtypes, including the SDC4, were not examined in that specific experimental context [Kuwata et al. DOI:10.1016/J.Legalmed.2024.102531].