Basic Information

Symbol
SDHA
RNA class
mRNA
Alias
Succinate Dehydrogenase Complex Flavoprotein Subunit A SDHF Flavoprotein Subunit Of Complex II SDH2 FP Succinate Dehydrogenase [Ubiquinone] Flavoprotein Subunit, Mitochondrial Succinate Dehydrogenase Complex, Subunit A, Flavoprotein (Fp) Malate Dehydrogenase [Quinone] Flavoprotein Subunit Succinate Dehydrogenase Complex Subunit A, Flavoprotein (Fp) Succinate Dehydrogenase [Ubiquinone] Flavoprotein Subunit EC 1.3.5.1 EC 1.1.5.- CMD1GG MC2DN1 NDAXOA PPGL5 PGL5 SDH1 Fp
Location (GRCh38)
Forensic tag(s)
Sudden unexpected death diagnosis Drug abuse diagnoses Postmortem interval inference Cause of death analysis Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_004168.4
Sequence length
2693.0 nt
GC content
0.5247

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-962.20 kcal/mol
Thermodynamic ensemble
Free energy: -1013.04 kcal/mol
Frequency: 0.0000
Diversity: 665.09
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((.((((((((((.((((((((((.....((((..((((((((((((..((((.(.((((((.(((((....))))))))..)))).))))..)(((((((((((((((..(......((((((...))))))..)..)))))).....(((((.....(((....)))...))))).((((((.((((((.(((..(((((....)))))..)))...((.((((((((((((.(((.(((((((((..((((((((.((((.(((.((((((........)))))).))).)))).))......))))))..))))).))))))))).)))))))))).))))))))))))))...((((((((((((.....((.((..(.((.(((.(((((((.((((.(((....)))))))(((((.(((((((((((((.((....(((..(((..........))))))))))))))..)))..))))))))).....((((((((.(((((((...(((..(((..(.((((.((((....((((.((.....((((..(..((((((...........((((......)))).((..((((..(((((((..(((.(((((.(.(.(((.....((((((((((......)))))((((((((.(((........))).)))))))).......(((((..(((((....))))).)))))(((((.(((....))).))))))))))..)))).).))))))))..)))))))..))))..))...((((.......))))))))))....)..)))).....))))))...)))).)))))..)))..)))..)))))))..))))))))...((((((.(((((((((((((((.(((((..((((((...((...))...))))))...)).))).)))))..........((((.(((.((((((((....((((((((..((((.....((.(((((..((((((.....((((((......))))))...))))))..))))).)))))).))))))))..))))))))))).....))))..)))))..)))))...))))))...........).)))))).))).))).)).))...)))))))))))))))))))))(((.....)))(((((((((.......((((((((.((((.((.(((((((((.((((...........((((((.(((((((.(((....((((((((((.(((((((..........((((((((((((.(.((......)).))))))))......)))))(((......))).))))))).))))))))))....))).))))))).((((((((((((((((.....((((...((((.((....))..))))))))...))))))))).......(((((..((((.(((((((.........)))))......(((.....)))....(..(((((((((((((((((....)))))))))).)))))))..)...........))..)))))))))((((((((........))))......)))).(((((((((((((....((.((.((...(((.(.((((.(......).)))).))))...)).))))...))))..(((....)))(((((.....))))).)))))))))((((.((((...((((((.((.((.(..((((((.((.(((((.((((...((......)).))))..)))))..))..)))).))..)))))...))))))....)))).)))))))).)))..(((((....)))))...((((.((.((((((..........)))))).)))).))...))))))...........)))).))).)))))).)).)))))))))))))))))))))...)))))....))))))....))))......)))).))))))....)))))))))))).(((((.((((.(((((((...(((.(((((((.(((((....((((.(((((......))))).)))).(((((((....)))).)))..))))).)))).))).)))...))).(((((((((((((......((((((((((((((.(((.((.((((((..(((...)))..)))))).)).)))..))(((((((.(((.((((((.(((((.........)))))..))))))...((((...))))...........(((((.(((......))).))))).........(((((((........((...((((((....))))))...))...........)))))))........)))..)))))))..((((((......))))))..)))))))))))).)))))))))))))........((((((((.((...(((((((((((.........))).)))))).)).......((((((((((.((((.(((((((((.((((((....))))))(((((((.(....((((.....))))..))))))))((.((((...)))).))..))))..))))).).))).)))))))))))).))))))))...(((..(..((((((....)))))).)..))))))))))).))))).......
Thermodynamic Ensemble Prediction
..((.((((((((({.,,{(((,(((..({((((...{(((({((((((..((((,({(({(((.(((((....)))))))),|))),.))))..)(((((((((.{,((({(({{{{({(,..(({...(({{{{{,.{||.,,,}},}}}})))....}||{,.{{||,..,|,{{|{({{((({({,(((.,,,..,,,||}.,}))))),.)))}.,}{,{||||||{{{{(,(((.((({{{({{||||{{{{|{.||||,||{.{(((((...,,,},}))))}.}}},|}}}.)),,....))})))}}}}))}.)))))))}},},))))))))}))).,,||,,..))...((((((((((((.....((.((.,(.((.(((.(((((((.,(((.(((....)))))),((((,,((((((({(((((.((....(((..(((.......,..))))))))))))))..)))..))))))))).....{{((((((.(((((((...(((..(((..(.((((.((((....((((.{(.....((((,.{.{((((((..,..,{{...((((......)))).{(..((((..(((((((..(((.(((((.(.{.(((..,,.((((((((((......))))}...(((((..((((((((,{,,,...}}||,|,,...,.||,{((..(((((.((.....)).)))))..))}))))))))))))).,))))),,)))).).))))))))..)))))))..))))..)}.,.{,,,,|,..}))),,)))))).}..,,.)))).....)}))))...)))).)))))..)))..)))..)))))))..))))))}|,.,((((((.(((((((((((((((.((({{..((((((...{,...,,...))))))...}}.))).)))))..,{{{....{{{{.{{{.((((((((....((((((((,.((((.....((.(((((..((((({.....((((((......))))))...))))))..))))).)))))).))))))))..))))))))))),,...}}}},,))))).,}))))...)))))).}...,,}}..),)))))).))).))}.)).)),.,)))))))))))))))))))))(((.....)))(((((((((.......((((((((.((((.((.(((((((((.((((...........((((((,(((((({.,,.....{{((((((((.(((((((....,....,((((((((((((.(,({,,....}|,}}}}}})).....,)))))|||,}}},.}}}.))))))).)))))))))|{...|}},)),}))}||,{||{{{{{{({((,..,..|{((|.{(,(({(..{{{{{{({|{{{(((...,)))),)),,},,}}}}}|,}}.,)))))){{|||......,,,)}}}}......{{{.....))),,..{..(((((((((((((((({....}))))))))).)))))))..}......{((.((((((.(((...((((((({{........})),....,}))))).)))))))))}))},},,|}||}||}|.{{,,{,{{||||,....||||}}},||}|.,{{...}}},.,}),|}|||,....||||{{||,,,..,||||{|,,,,.||}||||,||{|...((((((.{{,((.(..((((((.{(.(((((.((((...((......)).))))..)))))...),.)))).))..)}})),,.))))))....)}}).})))})}|.|||..({(({....)))))|,.((((.((.((((((..,....,..)))))).)))).))..,))))))...........)))).)))}}))))).)).)))))))))))))))))))))...))))).}},)}|}}|....|}}}...},,}))).))))))).}})))))))))))).{((((.((((.(((((((...(((.(((((((.(((((....((((.(((((......))))).)))).{{(((((....)))),}}}..))))).)))).))).)))...))).(((((((((((((......(((((((((((({{,(((.((.((((((..(({...})}..)))))).||.|||(({{{,((,.{...,,,,{{||}||{||,{{{,,,..}}))),,)),,,,.,}))}||||)}}}...,,,,.,,.{((({.(({......}}}.}}}||{{.,{{.....|}})|,,}}.,|,{,.,,||||{,,{{{||||,,.....}}}..}}},..,}}}|||{{{{,..,,,,..}.}))))},{{,,,,..,,..}))})),.}))))))))))),)))))))))))))........{(((((((,({...(((((((((((.........))).)))))).)).......((((((((((.((((.((((((((({((((((....))))))((((((({(....((((.....))))..)))))))){{.{{{{...}}}}.,}}}))),..))))).).))).)))))))))))).)))))))}.,,(((..{..((((((....)))))).}..))))))))))).))))}.......

Transcripts

ID Sequence Length GC content
AGGGACUGGCGGGACUGCGCGGCGGCAACAGCAGACAUGUCGGGGGUCC… 2549 nt 0.5190
AGGGACUGGCGGGACUGCGCGGCGGCAACAGCAGACAUGUCGGGGGUCC… 2450 nt 0.5208
AGGGACUGGCGGGACUGCGCGGCGGCAACAGCAGACAUGUCGGGGGUCC… 2693 nt 0.5247
Summary

This gene encodes a major catalytic subunit of succinate-ubiquinone oxidoreductase, a complex of the mitochondrial respiratory chain. The complex is composed of four nuclear-encoded subunits and is localized in the mitochondrial inner membrane. Mutations in this gene have been associated with a form of mitochondrial respiratory chain deficiency known as Leigh Syndrome. A pseudogene has been identified on chromosome 3q29. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014] CIViC Summary for SDHA Gene

Forensic Context

A study in human post-mortem brainstem tissue from SIDS and control cases identified the SDHA as the most stable reference gene for RT-qPCR normalization, with its use in combination with UBXN6 revealing a significant up-regulation of the target gene RPS27A in SIDS [El-Kashef et al. DOI:10.1007/S12024-015-9717-1]. In human forensic lung autopsy samples, including fatal methamphetamine intoxication cases, the SDHA was evaluated as a candidate reference gene and was found to be the fourth most stable among seven candidates, though RPL13A, YWHAZ, and GUSB were validated as the optimal set for normalization in that tissue [Du et al. DOI:10.1111/1556-4029.13199]. A study in human cadavers demonstrated that mRNA remains stable in liver tissue up to 48 hours postmortem, enabling gene expression analysis of the apoptotic thanatotranscriptome [Javan et al. DOI:10.1007/S12024-015-9704-6]. In a separate investigation of human autopsy tissues, the SDHA was validated as one of four stable reference genes for reliable normalization in RT-qPCR studies of hypoxia-related gene expression, which is crucial for generating biologically meaningful data in forensic contexts where differentiating causes of death, such as asphyxia versus cardiac death, is required [Huth et al. DOI:10.1007/s00414-012-0787-2].