| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGGACUGGCGGGACUGCGCGGCGGCAACAGCAGACAUGUCGGGGGUCC… | 2549 nt | 0.5190 | |
| AGGGACUGGCGGGACUGCGCGGCGGCAACAGCAGACAUGUCGGGGGUCC… | 2450 nt | 0.5208 | |
| AGGGACUGGCGGGACUGCGCGGCGGCAACAGCAGACAUGUCGGGGGUCC… | 2693 nt | 0.5247 |
This gene encodes a major catalytic subunit of succinate-ubiquinone oxidoreductase, a complex of the mitochondrial respiratory chain. The complex is composed of four nuclear-encoded subunits and is localized in the mitochondrial inner membrane. Mutations in this gene have been associated with a form of mitochondrial respiratory chain deficiency known as Leigh Syndrome. A pseudogene has been identified on chromosome 3q29. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014] CIViC Summary for SDHA Gene
A study in human post-mortem brainstem tissue from SIDS and control cases identified the SDHA as the most stable reference gene for RT-qPCR normalization, with its use in combination with UBXN6 revealing a significant up-regulation of the target gene RPS27A in SIDS [El-Kashef et al. DOI:10.1007/S12024-015-9717-1]. In human forensic lung autopsy samples, including fatal methamphetamine intoxication cases, the SDHA was evaluated as a candidate reference gene and was found to be the fourth most stable among seven candidates, though RPL13A, YWHAZ, and GUSB were validated as the optimal set for normalization in that tissue [Du et al. DOI:10.1111/1556-4029.13199]. A study in human cadavers demonstrated that mRNA remains stable in liver tissue up to 48 hours postmortem, enabling gene expression analysis of the apoptotic thanatotranscriptome [Javan et al. DOI:10.1007/S12024-015-9704-6]. In a separate investigation of human autopsy tissues, the SDHA was validated as one of four stable reference genes for reliable normalization in RT-qPCR studies of hypoxia-related gene expression, which is crucial for generating biologically meaningful data in forensic contexts where differentiating causes of death, such as asphyxia versus cardiac death, is required [Huth et al. DOI:10.1007/s00414-012-0787-2].