| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCUCGGCCCGGCAGGUUUCGCUCCCGCCCCUCCGGCCUUCCACAGCUG… | 6445 nt | 0.5505 |
Predicted to be located in mitochondrial intermembrane space. Predicted to be active in cytoplasm. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice demonstrated that perinatal lead (Pb) exposure altered adult hippocampal gene expression, where the SEC14L5 was identified as a top marker gene for oligodendrocytes in cluster 10 [Bakulski et al. DOI:10.1093/toxsci/kfaa069]. In a human study of trauma patients, the SEC14L5 mRNA was significantly downregulated in circulating T cells during the injury stage compared to the recovery stage [Rau et al. DOI:10.2147/JIR.S375881].