| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUGGCAGAGGCGGCGCCAGCCAUGUUGGCCGGGCGGAGGUCUUCGCUGA… | 3843 nt | 0.3950 |
The protein encoded by this gene is a member of the SEC23 subfamily of the SEC23/SEC24 family. It is part of a protein complex and found in the ribosome-free transitional face of the endoplasmic reticulum (ER) and associated vesicles. This protein has similarity to yeast Sec23p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The encoded protein is suggested to play a role in the ER-Golgi protein trafficking. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that chronic methamphetamine administration significantly upregulated the SEC23A gene in microglia, which is involved in the protein processing of endoplasmic reticulum pathway [Oladapo et al. DOI:10.3390/Ijms26020649].