Basic Information

Symbol
SEC61B
RNA class
mRNA
Alias
SEC61 Translocon Subunit Beta Protein Transport Protein Sec61 Subunit Beta Sec61 Beta Subunit Protein Transport Protein SEC61 Beta Subunit Protein Translocation Complex Beta SEC61 Translocon Beta Subunit Sec61 Complex, Beta Subunit
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_006808.3
Sequence length
564.0 nt
GC content
0.4929

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-176.50 kcal/mol
Thermodynamic ensemble
Free energy: -186.48 kcal/mol
Frequency: 0.0000
Diversity: 163.01
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......((((.(((((((.....((.((((...(((......)))..)))).))..(((((((((.....(((((........(((((((........)))..)))).....))))).....)))))))))...........((((((((((((.....)))))...)))))))))))))).(((((((..((((.((((.((((..((((((((((((((...((((((......))))))...))))))........((((((((((((...((((.((....))))))....(((....)))...)))))))))))).........)))))))).)))).)))).))))((........(((.(((.(((((.(((..........)))..)))))..))).)))........))....((((.(((((....(((......)))....))))).)))).(((((((((((((((.....).))))))))))))))......(((((((((....)))))))))))))))).)))).........................
Thermodynamic Ensemble Prediction
......(((((((.((((....}))).))),..{{{,{{.,,{{{.,|,,{{|{..{{{{{((((,,.,,{,(((,,,,....(((((((........}}}|,|}}}.,...}})))...,,))})|||||,{{{{,{{...((((((((((((.....)))))...))))))),,|||{}.||,....,}||,|}||||}|||{.,||(((({{{{({|{...{{||||,..,,,)}}}))}}}))}|||((,.....((((((((((((...((((.({....}))))).,..(((....)))...))))))))))))..}}},,..}|||||},.|||).)},,.,})})))}}},.,,{,|,{,{}||||,.{||}}}}.,{{.,||}..,,,,).}))}}))|{{{{,,,|,,....,{((.(((((....(({......})).,..))))).))||.(((((((((((((((.....)})))))))))))))).}}...,{{((((((....)))))))))}))))),.,))).........................

Transcripts

ID Sequence Length GC content
AGUCUCGCCAGCUGCCGGUCUUUCGGGGGCUCCGUAACUUUCUAUCCGU… 564 nt 0.4929
Summary

The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. Oligomers of the Sec61 complex form a transmembrane channel where proteins are translocated across and integrated into the ER membrane. This complex consists of three membrane proteins- alpha, beta, and gamma. This gene encodes the beta-subunit protein. The Sec61 subunits are also observed in the post-ER compartment, suggesting that these proteins can escape the ER and recycle back. There is evidence for multiple polyadenylated sites for this transcript. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that chronic methamphetamine administration significantly dysregulated the SEC61B in microglia, where it was identified as a component of the protein processing of endoplasmic reticulum pathway [Oladapo et al. DOI:10.3390/Ijms26020649].