| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCUCGCCAGCUGCCGGUCUUUCGGGGGCUCCGUAACUUUCUAUCCGU… | 564 nt | 0.4929 |
The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. Oligomers of the Sec61 complex form a transmembrane channel where proteins are translocated across and integrated into the ER membrane. This complex consists of three membrane proteins- alpha, beta, and gamma. This gene encodes the beta-subunit protein. The Sec61 subunits are also observed in the post-ER compartment, suggesting that these proteins can escape the ER and recycle back. There is evidence for multiple polyadenylated sites for this transcript. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that chronic methamphetamine administration significantly dysregulated the SEC61B in microglia, where it was identified as a component of the protein processing of endoplasmic reticulum pathway [Oladapo et al. DOI:10.3390/Ijms26020649].