| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGGCGGAGCGGCCAACAUGGCGGAACGCAGGAGACACAAGAAGCGGAUC… | 6526 nt | 0.3652 |
The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. The protein encoded by this gene and SEC63 protein are found to be associated with ribosome-free SEC61 complex. It is speculated that Sec61-Sec62-Sec63 may perform post-translational protein translocation into the ER. The Sec61-Sec62-Sec63 complex might also perform the backward transport of ER proteins that are subject to the ubiquitin-proteasome-dependent degradation pathway. The encoded protein is an integral membrane protein located in the rough ER. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that chronic methamphetamine administration significantly upregulated the SEC62 in cortical microglia, as part of a broader dysregulation of the protein processing of endoplasmic reticulum pathway [Oladapo et al. DOI:10.3390/Ijms26020649].