Basic Information

Symbol
SEC63
RNA class
mRNA
Alias
SEC63 Protein Translocation Regulator DNAJC23 SEC63L SEC63 Homolog, Protein Translocation Regulator PRO2507 ERdj2 Translocation Protein SEC63 Homolog DnaJ Homolog Subfamily C Member 23 SEC63 Homolog (S. Cerevisiae) SEC63-Like (S. Cerevisiae) SEC63-Like Protein PCLD2
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_007214.5
Sequence length
6430.0 nt
GC content
0.3953

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1728.10 kcal/mol
Thermodynamic ensemble
Free energy: -1856.48 kcal/mol
Frequency: 0.0000
Diversity: 1839.76
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(.(((((((((((.((.(....))).))))(((.(.((((.(((.((((((((.((((...((((((((((((...((((((.(((((((..(((.........))).))))(((.(((((((((.(((((((.((((..((.(.((((((((.((((.((((((((.(((((..((((((((((((.(((((((((.......)))....(((((..(((.......))))))))..(((((((..((((((.......((..((.((((..((((..((((((((((.......((((((((....((((.((((((...)))..)))))))........((((.....(((((((..((.(((.((((..((((((..((((.....)))).......((((((((((((.......))......(.(((((((((((.((((((..(((((((((((.(((........((((.......))))))))))))...))))))..(((((((((((................(((......))).((((((...((........))...))))))(((((((...((((.....))))....))))))).........))))))))))).......)))))).))))...........(((((.((((.((.((((((((...((((((....))))))((((((.((((.....)))).))....))))((((((((...(((((.((((((((........))))))))..)).)))....)).)))))).....((....)))))))))).)).))))))))).((((((((((.......))((((.(((.((.(((((((......((.((.......((((((((.....)))..)))))..(((((((...((((.((....)).))))...))))))).))..))....))))))).)).))).)))).....))))))))))))))).)...))))))))))...........((((((.......)))))).................))))))....)))).)))))..)))))))..)))).)))))))).(((((((((.(((((((((.((.((((....))))........(((....)))...((((.....)))).......(((((((((((.(((((.....((((........((((((((((...)))..))))..))))))))))))..))))(((((((((((((......((((((...(((((.((......)).)))))..))).))).((((((.((((((((.(((...((((.(((.((((.((...((((........)))).....)))))).)))(((((.......))))).....................((((((((............))))))))((((...(((((((((((((...)))).))...........((.(((...((((((.((.(..((((..(((.(((((..............))))).)))..))))..).))))))))...))).)).)))))))...((((((((......)))))))).)))).))))....))).)))))))).))))))..))))))((((((((.((((((.........).)))))..))))))))....)))))))........)))))))..)).)))))).....)))..))))))))).(((......(((((...........((((....)))).................(((((((...((....))...))).)))).......))))).....))).)))))))))))))))))).))..))))))))..)))))))............(((((.(.(((((((...(((((((((.....(((((......(((.((((((((......((((.((((((.((((.....))))...((((((..((((......(((..(((((((((.((((((((...........((.....))....((((....)))).((((...)))).(((((((((((((.(((((((((.((((.((((((((.((........)).))).))))).)))).)))..(((............))).(((((((((((((((((......(((.(.(((.(((.......)))......(((((((..((((((((((((.((((.(((((.(.((((.((((.....((.((((((((..((((((.((.....)))))))).)))))...)))))......)))).))))..).)))))..))))))))........((..(((((((((((.........((((((((.......((((((..(((.............((((((((((.((...(((((((((((((..((((((....(((..(((....)))..)))......((((((((.................(((((((((((..(((...)))...)))).))))))).((((((((.((((((.((((...((((((((((((.(((...((((..((((.....((((((((.......)))).))))....(((...........)))((..(((((....)))))..)).(((((((((((...............(((((((((((...)))))))))))....(((((......))))).)))))))))))........))))..)))).))).))))))))((((((........)))))).......))))...)))).)))))).)))))))).)))))))).......(((((......)))))....((((..(((((((........(((((...(((((..(((......((((((((.((........)).).)))))))......))).)))))..)))))......))))))).))))((((.....))))...(((((....((.....))....)))))...))))))....))))))))))))).....)))))))))))).....((.((((((((.((((((((((((......)))))......((.(((((...(((......))).(((.(((...(((.....)))...))).)))......))))).))...((((((((((((((((.(((((((....)))))))((((((((....)))))))).......((((((((.........)))))))).((((.....)))).))))))))((((((....))))))......))))))))..))))))).)))))))).))...)))..))))))((((((((........))))))))(((..(((((((((..((((((..........))))))..)))))))))..)))(..(((((((((...((((((.((.....((.((((((((..((.((((........))))))))))))))..)).....)).))))))...))))))).))..)..))))))))..((((((.((((((((((((((((.....((((.((((((((.((((((((.........((((((..((..((((((((((((.......((((((((.....(((.((((((((.....(((((..((.......................((((..(((......)))..))))............((((((((...........)))))))).))..)))))....)))))))).)))...((((....)))).....(((((((..((.(.(((.((((...(((((.(((.....))).))))))))).))).).))....)))))))........(((((..(..(((...........)))..)..)))))((((((((((..(((......))).((.((((((.(((.((((((((((..((((...(((((((..(((........(((((.((((((..((((((...........((((....))))((((.((((((((((.....(((.(((((.......))))))))((((.(((((((((((((...((((((.....(((..(((((((((((.(...((......)).((((((.((.(((..(.(.(((......))).).)..))).))))))))...(((((((((....)))))))))).)))))))))))..)))...(((......))).(((((...)))))....))))))))).)))))))))))))).)))))))))).)))).))))))...))))))....(((....)))........................(((((((((((((((((((...........))))))..........)).)))))).))).)).))))))))..)))))))..))))..))))).)))))..)))........)))))).))...(((.((.((.(((.(((((((((.....)))..))))))))).))))))).....))))))))))...............)))))))))))))))))))).))..)).))))(((((.((((......)))).)))))........((((((((((((((((((((.......(((((...)))))...((((((((.........)))).)))).))))))))).)))))))))))......))))))))))))))))))))....((((...)))).......((((((((((((((...(((...........)))...))).))))))))))).....))))))))(((((((((((((((...(((((((....))))))).)))))..))))))))))..(((((((((((((..............))))((((((.......))))))(((((((....((((((((.....(((.....)))....)))).))))))))))).(((((((((...))))))))))))))))))..))).))))).)))))))))))))))))..))))))))))..)))))))))).).)))...)))))))))))........))))))....)))))).)((((((...........)))))).....)))))))))))).......))))).))).)))))))))....)))..........((((.((....)).)))).....((((((......((((((.........))))))......)))))).))))..)))))).........(((.((........))))).)))))).))))(((((((......(((...)))......)))))))....(((((((..(((.(.....).)))..)).)))))((((.((((..(((..(((.......)))...)))..)))).))))..............((((((.....)))))).((((((....)))))).(((((((((..........))))))))))))))))).)))))))).)))))))))....))))))).)))))).(((((((...))))))).(((((((((.........)).))))))))))))).)))))..)))))..))..))))))))))((((....))))(((.(((......))).)))..))).)))).(((((((((...........))))).....)))).....)))))))).).)).)))).)))).))))))))))))..))).....))))))))).))).))))...)))))...)))).)))))..))).)))))))).)))((((..((((((((...))))))))...))))((((((.((((((.(((((((.....((((((((.......))))))))..............((..(((((...(((((((....(((((.........(((((((((((.......(((((((((...........((..(((((...(((.(.(((....((((((((..(((((...((((.((.((((((.................)))))).))))))..(((((...(((...))).)))))))))).))))))))...))))))))))))..))............))))))))))))))))))))..............((((((....))))))))))))))))))..)))))..))...)))))))......)))))).))))))((((((..........))))))......))))))).).....((((((((((((((...(((((....)))))....))))))..((((((....))))))..)))))))).
Thermodynamic Ensemble Prediction
.{((((((.,,,,,({({,({.{{,||.{{,{.,,.,.|,|},||,}|,||||||}||||}}|(((({(((((((,,.((((((.((({({({,({{,,,......))).)))){{{.(((((((((.{((((((.((((..((.(.((((((((,((,{,({{{({((((((..(((.((((.((((((((((.((((.......)))).).(((((..(((.......))}))))).))))))))).))))))).}||||.||||,|||}|||}},),},))),}))},.......((((((((....((((.(({({{...}},.,))))))}........((((.....(((((((.{(({(,,.((((,,((((({..((((.....))))..,||,.(((((((((({,.......,,......{,(((((((((((|((((({..{{{{|{{{{{||{{|,.......({{{....,,,,|,,}}}}}}}|,,|}}|||}{.{((({((((({{{{,,..,{{{{{,,,{{{|,,,.,|||{(({|{{..,{.........}..,,}))}}}||{,{{{...{{((,{{{.}}}|..,.||}}}||{||,||,|,|}}}}}}))))}}}}.,,}))))).))}),,,...,,,,,{((((.((((.({.((((((((.,.((((((....))))))((((,(,((((.....)))).})....)))){(((((((...{,(((.((((((((........))))))))..))),,).,..)).)))))).....|{...,)})))))))).)).))))))))).(((((((({{.......}}({((.(((.((.(((((((......{{.......,{.{{{{{{{(,,...))}.,}}}},..(((((((...((((.({....)).)))).,,)))))))})),.)}....))}}}}).}}.))).)))}.....))))))))})))))).....))))))))))...........((((((.......))))))..,..............))))))....)))).)))))..)))))))..)))).))))))))..........((((((((((((((((({(((({.(((((.....(((,...}}}.,,((((.....)))).......{,{(((((((..((((.....,(((({.......,,.(((((((...}))..))))..}||}|}||.,.,..{(((((((((((((......,,,((....,}.}||.....))))))))))))))..,,||||,||{|,(({((((,({,..,,.}}||||}{{(,(((({(({..((((........)))).....,|||||.||},{{{{.......)))},........,.{((((..(((,...|)))..)))))........,,,,}}{||,.,.,,.(((((,,,(({{{,,,|.,...,,,{{{...,.{((({{{,,((,(((({,,{,((,.{(({.((((({...({{,......}}}},,|||{,}|}|,.|.,}}}}}}),.,}}),)).,,}},,,)))},|,}}}}}}.,,.))),.)),)),,)}))))}..}}})}))),,,))}))),,.}}))))))||||||||}||||||}}}}}.,,.)))),},)))),.))))))),,,..,}}..,.....))))),...((((((.,(({..,((((((((.((.((((((......(((((...........((((....)))).................(((((((.,.((....))...))),,))).......))))).....))).))).))..{..((((((((......(((((((.(((((.((((....(((.,{{,((((((((.(((((((((((((({...((((((((((....((((((...{.((((({.,((((((,.{.((((.....)))),....,,..............(((,.(((((((((.((((((((.,.........((.....))....((((....)))).{(((...)))}.((((((((((((,.,((((((((.((((.((((((((,({.,......}}.)}}.))))}.)))).)))}|{{{...,,,,,.,,,|||{{{,,,,(((((((((((...((.(,({({({(.,,....,|}})),|.|.{,(((((((..(((((((((((,{((((.(((((.{,({({.{(((....,||.{{{(((((..((((((,({.....)))))))).)))))...}}}||.,,.,.}))}.},)),.,.)))))..))))))))........({..(((((((((({,,,,{....{{(((({{,...{{.((((((..((({{{,.,,,,{,..((((((((((.((,,.(((((((((((((..{{((((((((((((((((....)))..,({{{{,.,({{,(((({......})}},.....(((((((((((..{((...}))...)))))))))))).|||{((((,{{((((,((((,{,({{{{(((((({,{{{,,,{(((|.{{{{.....{(((((((.,...,.)))),,}))....{|{........,,.})}{{{|{{{{,.,,,)))))}}))}(((((({{{{{.....,|,,,,.,..(((((((((({...}))))))))))....({(((......))))).}))))))}))),|,}}},,},))}})),|{{{|{||||||},((((((........))))))..,{{{{||,,...||||,||,}||,,,,}}},.}))}}}}},.......,{{{{......)))}},}}}||{{,,{{{|{||...,||||{(({{...{{{{{,,|||...|,.{(((((({.{(,,,....,))},.))))))),,....))).}))))..)))))}})}}})))))...)))))))))....|{{|.,{(({{,..{({,...,}||,.,|}},.})))})))}),.,,)))))))))))))..,,.))))))))))))....,|{.((((((((.((((((((((((......)))))......((.(((((,,,(((,{.,..,}|{(((,.....|||,,,},..,|,||},}}}.....,,.))))).)),..{((((((({(((((((.(((((((....)))))))((((((((....)))))))).......,{{((((({,,,.....}))))))}.((((.....)))}.})))))))((((((....))))))......}))))))}..))))))).)))))))).)),,.,))..))))))||{{{{{{...,,,,{|,,||||,(((..(((((((((..((((((.,........))))))..)))))))))..)))}}}},,||||||...{{{(((,({.....,|,||{(((((..{{.{,{{|||.....))))})))))})))},}}.....}).))}}},.,{||,}|||.{|{{{..,,}))))).,,{{||,.||||{{{{{({{((({,....{(((.((((((((.{(((((((........,{{({{,,{({{|{{{{{{{{((((.,,,,,{{|{{||{{{,...(((.((((((((.....(((((,||({{{{{{..||,((({{.......,..|})))...,,..)))}})),),,..........((((((((...........)))))))).,,..)))))....)))))))).))).,.,})}}.|||},,,,,,.(((({{{,,{{,{.,,({((((.{{(((((.,,,,}}}})),,)))))}},,.}}}...}},,..}))))))......,,(({((,,{..{{{.,,,,,.,...}}},.,..}}}}}{(((((((((..{{(,,..,,||,{((.((((((.(.(((((((((((.{{(,,(({.((((((,.{((({.{{.{(.((((((.(((({.........,(((((...(((((...{|({{,..,,}||||,,}))))...))))}|((({{{,{((((((,,..{(((,{((((((((((((...((((((,,.,,{{(,,((((((((((,,{,...|,,...,||.((((((.((.(((..{.(.(((......))).).}..))).))))))))..|(((((((((....)))))))))}.))))))))))),,)))}},.,|,.}},.(((((...)))))........})))))))).)))))))))|||||{{||,,,..||.)))),))}},}...,)))}.....))))))}.},..........................((((((((((((((((,...........}},,,,..,,,,....)).)))))).))).{{{{{{....{{{|||,|||.....,,}),)),})))))})))}})}))}}})))))))))}}.}}))))))))))).)))..}}},)}))))}})))).))))))},}))))}},,,,))))))))))||||.|}}}}},||,|||||||||||,|}}|}}},.|,.|||.,}}}{((((.((((......)))).))))}.,,,....((((((((((((((((((({.......(((({...})))).,.((((((((.........)))).)))),))))))))).))))))))))).}},..}))))))})))))))))))}{{{.((((...)))).,}},..((((((((((((((..,((,...........}))...))).))))))))))).,,,,))))}}}}{{{{{{{((((((((...(((((({....))))))).))))),.))))}))})}||{((((({{{{(({..............}}},{(({{{.......))))}}(((((((....({{{{{{{,,}|,|{{,,,,,}},....)))),)))))})}))).(((((((((...)))))))))|,}}|||||..))),)))})})))}}}}))))))))))..)))))))))),,)))))))}|}...})},,,))))))))))),......,|}}|}||...,}},}},}|{{{{{..........,)))))),,}..))))))))))))......,)))))}})).)))))))))..,.}))..........((((.((....)).))))......{{{{{......{{(({{.......,,|}}}}}......))})))}))))))))))))),...)))))))))))))))),,,((((..{{{....}}))|{{|||}.||,.({,...,}}......}}}},,.....(((((((..(((.(.....).)))..)).)))))((((.((((..(((..(((.......)))...)))..)))).))))}))))))))))))))...))).))))).....((((((....)))))),(((((((((..........))))))))))}}.)))..)))),))))).)))))))..((((((((...))))))))....((((.(((((..(((((((((.........)).))))))).)))))))))..))))))))..).)))))))))}}.,,.))))))...((((((((..((..(((,...}}),,)}..))))))))..})))},..)))))))),}))))))))...)))))))).).)).)))).))))))})))))))))},.}}}.....))))))))).))),)))}..,|||||...,,,),}))))..))),)||||||},|||{{{{,,|{{(((((...,}}}}}}),,,}}}}((((((.((((((.{{{{{{{.,,,.((((((((.......)))))))).}}|,.,.......((..(((((.,.(((((((....(((((....,{{,.((((((((((,........(((((((({.........})))))))),|{{((((((((.{{..{(((((((..(((((...((((.((.(((({{.................)))))).))))))..(((((...(({...})).)))))))))).)))))))|{.,......,,},,|......,.....,,}))))))}})})))))))))))....,,,,.,}}},((((((....)))))))))))))))))).,)))))..)).,,)}))))}......)))))).)))))){{{(({..........}}}}}}......,,,,||{{{,...{(((((((((,,,,,...|||||..}})))))}...,,}}},..||||||},..}}}}}},)))))}....

Transcripts

ID Sequence Length GC content
CUCUCGCGAGAGCUGGCGACGGCGGCGGCAGCGGCAGAGGUGGCGGCGG… 6430 nt 0.3953
Summary

The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. The protein encoded by this gene and SEC62 protein are found to be associated with ribosome-free SEC61 complex. It is speculated that Sec61-Sec62-Sec63 may perform post-translational protein translocation into the ER. The Sec61-Sec62-Sec63 complex might also perform the backward transport of ER proteins that are subject to the ubiquitin-proteasome-dependent degradation pathway. The encoded protein is an integral membrane protein located in the rough ER. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that chronic methamphetamine administration significantly dysregulated the SEC63 gene, which is involved in the protein processing of endoplasmic reticulum pathway, in microglial cells as revealed by single-cell RNA sequencing analysis [Oladapo et al. DOI:10.3390/Ijms26020649].