| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCUCGCGAGAGCUGGCGACGGCGGCGGCAGCGGCAGAGGUGGCGGCGG… | 6430 nt | 0.3953 |
The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. The protein encoded by this gene and SEC62 protein are found to be associated with ribosome-free SEC61 complex. It is speculated that Sec61-Sec62-Sec63 may perform post-translational protein translocation into the ER. The Sec61-Sec62-Sec63 complex might also perform the backward transport of ER proteins that are subject to the ubiquitin-proteasome-dependent degradation pathway. The encoded protein is an integral membrane protein located in the rough ER. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that chronic methamphetamine administration significantly dysregulated the SEC63 gene, which is involved in the protein processing of endoplasmic reticulum pathway, in microglial cells as revealed by single-cell RNA sequencing analysis [Oladapo et al. DOI:10.3390/Ijms26020649].