Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCUGUUCUUGGCUGACUUCACAUCAAAACUCCUAUACUGACCUGAGAC… | 3875 nt | 0.4227 |
Summary
The protein encoded by this gene is found in cytokine-stimulated endothelial cells and is thought to be responsible for the accumulation of blood leukocytes at sites of inflammation by mediating the adhesion of cells to the vascular lining. It exhibits structural features such as the presence of lectin- and EGF-like domains followed by short consensus repeat (SCR) domains that contain 6 conserved cysteine residues. These proteins are part of the selectin family of cell adhesion molecules. Adhesion molecules participate in the interaction between leukocytes and the endothelium and appear to be involved in the pathogenesis of atherosclerosis. [provided by RefSeq, Jul 2008]
Forensic Context
A study in human aortic endothelial cells demonstrated that SELE mRNA expression is significantly regulated at 24h and 72h post-irradiation with X-rays, serving as a marker to differentiate unirradiated (0 Gy) samples from dosed samples and to classify radiation dose classes [Chopra et al. DOI:10.1038/s41598-022-24051-6]. In human corpus cavernosum tissue, SELE was identified as a gene marker highly expressed in the EC2 endothelial subcluster [Zhao et al. DOI:10.1038/s41467-022-31950-9].