| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGAGCGCACCGGAAGCGCCCGGCUGGAGGCGCGGCGGCAGGGCUGGGC… | 1218 nt | 0.4803 | |
| AGGAGCGCACCGGAAGCGCCCGGCUGGAGGCGCGGCGGCAGGGCUGGGC… | 1482 nt | 0.5000 |
This gene encodes a transmembrane protein that is localized in the endoplasmic reticulum (ER). It is involved in the degradation process of misfolded proteins in the ER, and may also have a role in inflammation control. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Two additional phylogenetically conserved stem-loop structures (Stem-loop 1 and Stem-loop 2) in the 3' UTR of this mRNA have been shown to function as modulators of Sec insertion. An alternatively spliced transcript variant, lacking the SECIS element and encoding a non-Sec containing shorter isoform, has been described for this gene (PMID:23614019). [provided by RefSeq, Jul 2017]
No relevant information is available at the moment.