Basic Information

Symbol
SELENOT
RNA class
mRNA
Alias
Selenoprotein T SELT Thioredoxin Reductase-Like Selenoprotein T Thioredoxin Reductase-Like Enzyme EC 1.8.1.9 SelT
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_016275.5
Sequence length
3437.0 nt
GC content
0.3489

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-859.00 kcal/mol
Thermodynamic ensemble
Free energy: -932.27 kcal/mol
Frequency: 0.0000
Diversity: 868.42
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((.((((((((((((((((((((.((((((((...))))).)))...)))))))).((..((((((((((((....(((.((((.((...)).)))))))..((((((.....))))))...........))))))....))))))))))))))).))).))...)))).)))).......(((((.....((((((((((..((.((((.(((.((((...)))).))))))))))))))))))).((((.((((........)))).))))..........((((..............))))((((((((((((.........((((((.(((((((.((((((((.......((((......)))).((.((((((((((((((((..((((((..(((......((..((((((((.(((((((((((((.((.((.....)).))..))))))))(((((.....(((((((((((................)))))))))))(((((....((((..(((((((.....(((((..(((((........((((..(((........))).))))........))))))))))...........))))..)))..)))))))))...(((((((((((((((.(((((((((.(((.....((.(((((((((((.(.(((.(.....(((((((((((((...(((((....)))))))))))).......))))))...)))).).)))))...)))))).))..))).))))))))).))).))))))))))))...............)))))..)))))..)))).))))..))......))).))))))....((((....(((.((.....)).)))..))))............(((((...))))).(((((((((((((((...((((((....(((((((.(..((((((.....))))))..).)))))))...(((((((((.((((.((.(((((......((((((.........))))))...............(((((((((.........))))))))).....))))).)))))).)))))))))....(((((((((((.((...((((((...((((((((((((.((.(((..((.(((((((....))))))).))...))))))))))...)))))))..))))))..)).))))).............................((((((............(((((((.(((((((((..((((((((...(((((.((((((((.........((((........))))...(((((((((..((((((....(((((((((((.((....)).))))))..))))).......((((((........))))))..))))))..))))))))))))))))))))))......))))).))).))))))))).)))))))..................(((((((((....(((...)))..)).)))))))..(((((((((....((...........))...))))))))).....((((.((((((....(((((....((((((((((.(........).)))))))))).)))))........(((((((.((((...(((((....(((((..(..(((((......(((((((((.....(((....)))...))))))))).)))))..)..)))))...)))))...)))).))))))).)))))).)))).))))))....((.((((((...((((.....))))..))))))))...)))))).)))))).))))))))))))))).(((((..((....((((((((((((......)))))).)))(((((((((((((((...((....))...))))))))))))))).............((((((((...)))))..)))......(((((((((...))))))))).(((((((((((...)))))))))))..((((((....)))).))..(((((((....)))))))...((((......((((.((((((((((...(((((....(((..((((.......))))..)))....)))))..)))..))))))).)))).....))))))).))..)))))....)))))))))))).)))).))..........(((.((.(...(((((((((.((....)).)))))))))...).)).))).......((((((((((((......(((((((...((.((.((((........)))).)).))....((((((......))))))...)))))))..)))..)))))))))..)))))))).).))))))(((((((.(((.......(((.....)))(((.(((((((((((((((.(((..........))).))))))))..))))))).))).....(((.((((......)))))))..(((((((((..........)))))))))(((((((..(((((((((((((......((((....(((......)))....)))).((((((((..(((((((............((((((.....))))))((((((.((.....(((((((.......(((((...))))).......))))))).....)).)))))).......(((((...(((((((.((.(((((........(((.((((((.....((((..((.((((((.(((..((((..(((((.(((((((((.......)))))....)))).)))))....))))..))))))))).))..(((((((((((.........))))))))))).(((((.(((((................((((((.....((((......)))).....)))))).(((((((.(((((((....))))))).)))))))......................(((.....)))...(((((((((......))))))))))))))))))).)))).....)))))).))).....(((((((((......))))))))).))))))).)))))))...))))).....)))))))....((((((((.........(((.((((((...(((((...(((......)))....)))))..)))))))))))).))))))))))))))))))..))))))))((((((...))))))...........)))))))..........))).)))))))....))))))((((((((((((........))))))))))))((((.......))))..)))))))))))).)))))..((((...((.(((......))).))...)))).
Thermodynamic Ensemble Prediction
((((((((.((((((((((((((((((((.((((((((...)))))),)}...)))))))).{(..(((((({{({(({{{,(((.((((.((...)).)))))),..((((((,...,))))))...........}}}))),,..))))))})))))))).)))},)...))))}}}}}.,,....(((((.....(((((((((({.((.((((.(((.((({...}))).))))))))))))))))))).{(((.((((.,......)))).)))}..........((((...{,....,....))))((((((((((((.........((((((.{{{{(((.((((((((,......{{{{..,,,,)})).||,{(((((((((((((((..((((((..,{{.....,(({,(((((((,{((({{{{{{{{{{.{(,((,,,..||,||.,||||}|||(,{(({{{{.(((((((((((,,{{.....,}},...)))))))))))(((((....((((,.{((((((.....,,,(({,(((({.{{....{((((..(((........))).))}},,....}})))),,))))}..........}))}..))),.)))))))))....((((((((((((((.(((((((((.(((.....((.(((((((((((.{.(((.{.....((((((((((((({..{((((....)))))))))))).......)))))).,}}))).}.)))))...)))))).))..))).))))))))).))).))))))))))))}}}}}.,}}}..,,,|||||,.}}}}}.,))))},,,),,))}}}}}}))),))))))....((((....(((.((.....)).))).,))}}............{((({...,)))}.(((((((((({{(((((.((((((..,{({(((({.{,,((((((,,,..))))))..}.))))})}.,,(((((((((.((((.((.(((((...,,{(({(((.......,,}})))}...,,,,........(((((((((.........))))))))).....))))).)))))).)))))))))....{((((({{(({,((.,.((((((...((((((((((((.((.(((..((.(((((((....))))))).))...))))))))))...)))))))..)))))},,}}.})}}}.,.,{,|,,,,,..,,,,,..........{((((({{,,......,,(((((((.{((((((((..((((((((..,((((,,(((((({{.........{{{{........}}}}...{((((((((..((((((,,,,(((((((((((.{,....}}.))))))..))))),}}}...((((((........)))))).,))))))..))))))))}})))))))))))}......))))).))).)))))))),.)))))))......{{{{{...{{..{(((((({{....(({...}}}..,,.}}}}))}..||{{...|)))).|||||,..|,|,,}}...,||||||.,.....||||}|(((......,{{||,...((((((((({,(........},)))))))))).,,,,,..,,,,,.,,,{||||{{{{,,.{|||||,..(((((|,,,.|||||....,,|||||{{{{,,...{{{...,)))...)))))))}).}},,,..},,,}}}),..},},....,},}}},)}}})}}}}}},,}}}}.}))}}}....,|.|{((((...((((.....))))..)))))))),,.)))))}.)))))).))))))))))))))).{{{{({,(({{{,{.,{{{{{{{{,,,,{{{||||||,|,,,{{{((((((((((({,.{{....,|..,}}}}))))))}}}}}.....,,,,,,..||{{((((...)))))..,))}}}}}}|||||||||,..))))))))}.(((((((((({...}))))))))))..|{{(({....}))},||,,{((((((....))))))|.,,||||......((((.((((((((((.,.((({{,{,.(({{{{{{(,....,})))},}))).,.,))))),.))).,))))))).)))),..,.))))))},)},}))))}....))))))))))))},))},}}....,,,,..{{(.((.(...(((((((((.((....)).}))))))))..,|.}).}}}.......(((((((((,,,...,,.(((((((,,,,,.,{,{{{{,...,,|{|{||{,,.|||...{{{{{|..,,,.}}}}}}...)))))))..}),..)))))))))..}))))))).,,)}))))(((((((.(({.......,,,...,,|||(((.(((((((((((((((.(((.,....,,..))).))))))))..))))))).))).,|||{{(,({{{......})))}}},.{((((((((..,....,..))))))))|(((((((..(((((((({{(({......((((....(((......)))....)))).((((((({..(((((((...,{,...,..,{{{|{.....}}}}||((((((.((.....(((((((.......(((((...))))).......))))))).....)).))))))..,,,..,((((...(((((((.((.(((((........(((.(((((,.,,{,,(((..((,((((((,(({..((((..(((((.(((((((((.......)))))}...,))).)))))....))))..))}}))))).)),,|((((((((((.........))))))))))}.(((((.(((((................((((((.....(((({....,)))).....)))))).(((((((.(((((((....))))))).))))))).,,{.,{{,{{|,,,.......||||,,..}}}...{|||{{{{{....,,))))})))))))))))))).,))),.}},)))))).))).....{((((((((......))))))))}.))))))).)))))))...))))}}},,.)))))))...,((((((((,........{((.((((((...(((((...,{{,.....))).,..}))))..))))))))))))}}))))))))))))})))}..)))))))){(((({...}))))}...........}))))))}.........))).)))))))....}))))}((((((((((((,,,....,))))))))))))|{{{......,})}}..)))))))))))).))))).,{|||.,.{{.{{{......}}}.}}...)))}.

Transcripts

ID Sequence Length GC content
GCAGUCUGUCUGAGGGCGGCCGAAGUGGCUGGCUCAUUUAAGAUGAGGC… 3437 nt 0.3489
Summary

This gene encodes a selenoprotein, containing a selenocysteine (Sec) residue at the active site. Sec is encoded by the UGA codon that normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. This protein is localized in the endoplasmic reticulum. It belongs to the SelWTH family that possesses a thioredoxin-like fold and a conserved CxxU (C is cysteine, U is Sec) motif found in several redox active proteins. Studies in mice indicate a crucial role for this gene in the protection of dopaminergic neurons against oxidative stress in Parkinson's disease, and in the control of glucose homeostasis in pancreatic beta-cells. Pseudogenes of this locus have been identified on chromosomes 9 and 5. [provided by RefSeq, Sep 2017]

Forensic Context

A study in mice demonstrated that the SELENOT gene was significantly enhanced in the brains of animals subjected to 25 minutes of neck ligation-induced hypoxia and dissected immediately after death (Group A25-0) compared to controls, as confirmed by fluorescence differential display PCR, comparative RT-PCR, and statistical analysis using ANOVA with post hoc tests [Ikematsu et al. DOI:10.1016/J.Forsciint.2006.08.015]. In human traumatic brain injury, the SELENOT mRNA was found to be down-regulated by 47% in one patient with vasculitis and by 57% and 43% in two TBI patients, indicating differential expression in human brain trauma [Michael et al. DOI:10.1016/j.jocn.2004.11.003].