| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGUCUGUCUGAGGGCGGCCGAAGUGGCUGGCUCAUUUAAGAUGAGGC… | 3437 nt | 0.3489 |
This gene encodes a selenoprotein, containing a selenocysteine (Sec) residue at the active site. Sec is encoded by the UGA codon that normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. This protein is localized in the endoplasmic reticulum. It belongs to the SelWTH family that possesses a thioredoxin-like fold and a conserved CxxU (C is cysteine, U is Sec) motif found in several redox active proteins. Studies in mice indicate a crucial role for this gene in the protection of dopaminergic neurons against oxidative stress in Parkinson's disease, and in the control of glucose homeostasis in pancreatic beta-cells. Pseudogenes of this locus have been identified on chromosomes 9 and 5. [provided by RefSeq, Sep 2017]
A study in mice demonstrated that the SELENOT gene was significantly enhanced in the brains of animals subjected to 25 minutes of neck ligation-induced hypoxia and dissected immediately after death (Group A25-0) compared to controls, as confirmed by fluorescence differential display PCR, comparative RT-PCR, and statistical analysis using ANOVA with post hoc tests [Ikematsu et al. DOI:10.1016/J.Forsciint.2006.08.015]. In human traumatic brain injury, the SELENOT mRNA was found to be down-regulated by 47% in one patient with vasculitis and by 57% and 43% in two TBI patients, indicating differential expression in human brain trauma [Michael et al. DOI:10.1016/j.jocn.2004.11.003].