Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| GACAUUCAGUGCAGUCUACCUGCAGCACAGCACACUCCCUUUGGGCAAG… | 2358 nt | 0.4355 |
Summary
This gene encodes a cell surface adhesion molecule that belongs to a family of adhesion/homing receptors. The encoded protein contains a C-type lectin-like domain, a calcium-binding epidermal growth factor-like domain, and two short complement-like repeats. The gene product is required for binding and subsequent rolling of leucocytes on endothelial cells, facilitating their migration into secondary lymphoid organs and inflammation sites. Single-nucleotide polymorphisms in this gene have been associated with various diseases including immunoglobulin A nephropathy. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2009]
Forensic Context
A study in humans demonstrated that the SELL gene, encoding CD62L, was identified as a candidate human identification SNP (rs1051091) located within the SELL gene, which was highly expressed in whole blood and part of a 24-SNP panel achieving a mean match probability of 4.5·10^-9 from low-template samples [Jepsen et al. DOI:10.1016/j.fsigen.2024.103089]. In a separate investigation of human skin tissue, SELL gene expression was significantly higher in T cells from burn-injured tissue compared to non-burn tissue, indicating a shift toward a circulating T cell phenotype associated with injury [Labuz et al. DOI:10.7554/eLife.82626]. A study in mice demonstrated that selectin, lymphocyte (Sell) was significantly upregulated (265.088-fold at 12 hours) in skeletal muscle following an incised injury, as identified through DNA microarray analysis [Gaballah et al. DOI:10.1016/j.forsciint.2016.06.027].