Basic Information

Symbol
SELP
RNA class
mRNA
Alias
Selectin P PADGEM GMP-140 GMP140 CD62P CD62 PSEL GRMP Platelet Activation-Dependent Granule To External Membrane Protein Platelet Activation Dependent Granule-External Membrane Protein Selectin P (Granule Membrane Protein 140kDa, Antigen CD62) Leukocyte-Endothelial Cell Adhesion Molecule 3 CD62 Antigen-Like Family Member P Granule Membrane Protein 140kDa Granule Membrane Protein 140 P-Selectin LECAM3 Selectin P (Granule Membrane Protein 140kD, Antigen CD62) Platelet Alpha-Granule Membrane Protein Granulocyte Membrane Protein CD62P Antigen Antigen CD62 GMRP
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Wound age identification

MANE select

Transcript ID
NM_003005.4
Sequence length
3157.0 nt
GC content
0.4957

Transcripts

ID Sequence Length GC content
AGCAGUCUGGGUUGGGCAGAAGGCAGAAAACCAGCAGAGUCACAGAGGA… 3157 nt 0.4957
Summary

This gene encodes a 140 kDa protein that is stored in the alpha-granules of platelets and Weibel-Palade bodies of endothelial cells. This protein redistributes to the plasma membrane during platelet activation and degranulation and mediates the interaction of activated endothelial cells or platelets with leukocytes. The membrane protein is a calcium-dependent receptor that binds to sialylated forms of Lewis blood group carbohydrate antigens on neutrophils and monocytes. Alternative splice variants may occur but are not well documented. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human platelets demonstrated that the SELP mRNA and protein are significantly upregulated in septic patients compared to healthy controls, correlating with increased mean platelet volume and higher P-selectin expression [Szilágyi et al. DOI:10.3390/ijms21030866]. A study in human skin wounds demonstrated that the SELP is present on the endothelial cell surface a few minutes after injury, with a significant increase observed in wounds aged 15–30 minutes, and it has been detected in the interval between 3 minutes and 7 hours post-injury for age estimation [Ros et al. DOI:10.3389/fmed.2021.786798].