| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCAGUCUGGGUUGGGCAGAAGGCAGAAAACCAGCAGAGUCACAGAGGA… | 3157 nt | 0.4957 |
This gene encodes a 140 kDa protein that is stored in the alpha-granules of platelets and Weibel-Palade bodies of endothelial cells. This protein redistributes to the plasma membrane during platelet activation and degranulation and mediates the interaction of activated endothelial cells or platelets with leukocytes. The membrane protein is a calcium-dependent receptor that binds to sialylated forms of Lewis blood group carbohydrate antigens on neutrophils and monocytes. Alternative splice variants may occur but are not well documented. [provided by RefSeq, Jul 2008]
A study in human platelets demonstrated that the SELP mRNA and protein are significantly upregulated in septic patients compared to healthy controls, correlating with increased mean platelet volume and higher P-selectin expression [Szilágyi et al. DOI:10.3390/ijms21030866]. A study in human skin wounds demonstrated that the SELP is present on the endothelial cell surface a few minutes after injury, with a significant increase observed in wounds aged 15–30 minutes, and it has been detected in the interval between 3 minutes and 7 hours post-injury for age estimation [Ros et al. DOI:10.3389/fmed.2021.786798].