Basic Information

Symbol
SEMA3A
RNA class
mRNA
Alias
Semaphorin 3A Hsema-I Coll-1 SEMA1 SEMAD SemD Sema Domain, Immunoglobulin Domain (Ig), Short Basic Domain, Secreted, (Semaphorin) 3A Semaphorin III Semaphorin-3A Sema III Semaphorin D Semaphorin L Collapsin 1 Hsema-III SEMAIII COLL1 SEMAL HH16
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_006080.3
Sequence length
8113.0 nt
GC content
0.3667

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1991.60 kcal/mol
Thermodynamic ensemble
Free energy: -2142.49 kcal/mol
Frequency: 0.0000
Diversity: 1672.36
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((.((((..((((((((((((...(((((((((((((.(((((.((((.((((.(((((...(((.(((((...........(((((((.....................)))))))))))).)))...)))))..)))).))))))))).(((((...((..((((((....(((....(((((((..((((((((..((((((((..((((((.(((((((((((((((...(((.....))).((....))...((((....)))).((((....((.((((..(((((((..(((((.........((((((...))))))((((((((.((((.....(((...(((((((((((.(((.((((.((........))))))..))))))))........)))))))))))))))))))))..............((((....)))))))))))))).......)).))))))...))))...)))))))))))....((......))......))))))))))...((((.((((....((((((((((((((..((((.((...(((((((((......(((.(((((..(((((((((((.........(((((..((((((...(((((.((.(((((.((.(....((((((((.((((....)).)).))))))))..))).))))).)))))))....(((((..((((....))))..(((((..((....(((((....((((((((....(((((((((((((.((((((.(((((((....(((((((((.((.(((((((..(((((.(((((.(.(......)).)))))...)))))...(((((........))))).)))))))..(((((((((.((.......))))).))))))....((((((((.((((..(((((....((......(((((....))))).....))...)))))..)))).)))).....))))......)).)))))))))....))))))).))........(((..((((.(((...((.((((((((..((.(((((((((........))))))))))).)))....))))).))..)))))))..))).................))))))))).))))))))..)))))))).......))))).......))..)))))((((..(((((.........)))))..))))......))))).......(((((((...(((...))))))))))......))))))))))).........)))))))))))..))))))))((((((...((((.((((((((........)))))).)).......)))).)))))).(((((((((...((((((..((((((....((((.(((...(((((.(.....((((((.(((((((......))))).........((((((((...)))))))).....))))))))....).))))))))...((((((((..((...))..))))))))......(((((((((((((((((...((((((((......(((((....)))))..(((..(((.((.(((((..((((((((........)))))))))))))..)).)))..)))........(((((((..((((..........(((((((((((.....(((((((....)))))))........)))))))).)))))))..)))))))((..((((((((((((((((((..((((((((.((((((((.((((.((((((.((((.((.(((((((((....(((........)))......................(((....)))(((((.....).))))...(((((((((((..((..((.(((....))).))..))....))))....)))))))))))))))))).))))...))))))...)))).))).))))).)))....)))))...))).......)))))))...((((((...........((((......((((((...))))))......))))....(((((((....(((...)))..))))))).....((((........)))).....(((((((....)))).)))...)))))).((((((..((((((.(((((((..((((.....(((((((((...))))).)))).....)).))..)))))))..............((((((....((((((..(((.((((((...))))))..)).)...))))))((((((((........................))))))))...........(((((........))))).........(((....))).))))))...))))))..((........))......((((........))))..((((((.((((((((......((..((((((((((((....(((((((((((((((........(((((.........(((((....))))).((((.......)))).......(((((......((((((.....)))))))))))..(((((((((((.(((((((((..((((....)))))))))).))).)))))...))))))...............((((........)))).......(((((............)))))((((((((((...((((((((((((.....)))).(((((((((((.....(((((((((((.(((((((((((..((.(((((....((((.((((((......(((((.....((((........((((((((((.((((.((((((((((...))))))).......))))))).))).....)))))))....)))).....)))))(((((((..(((((.....)))))....(((((((.((........)).))))).))....((((((((((.(.(((((((((((......((((..((((((.(((((........((((((...(((((((((.........(((((((((((((((((.....((((.........))))....))))...)).)))))))))))...(((((((...........((((((..(((((((((......(((((........)))))..((((((....))))))......((((.....((((((((((((..........(((((((((.((.(((((..(((((..((((((....((((...))))....))))))...))))).)))))..))..))))))))).((((.....)))).....(((((.(((((......))))).)).)))............))))))))))))..))))(((.((((((.................((..(((((.(((((..((((((((.............))))))))...))))).)))))..)).......(((((((((((((((.....)))).))).))))))))))))))...))).)))))))))))))))........((((.((((((((((((..(((((((((.......(((((((...(((((..........)))))....)))))))...((((((((((((((((((....))))))))...........((((.....))))..)))))))))).....)))))...))))..))))).))))))).)))).....(((.....(((((....(((((.((((...((((.(..((((((((((((.((((((..((...(((((((.(((((((((....))))))((((((((((((...(((((((.((((((.((((((((.(((....(((((..................((((((((((......(((((((......(((((((.((.((..((((((.((...(((....)))(((((.....)))))........(((((((((........((((((((.(((((((((((....(((...)))...........((((..(((.....))).)))).....((((......))))((((.....)))).((((...((((((......))))))....)))).....((((...((((...))))......))))................))))))))))))))...............))))))))))))))..)).))))))..)).))..))))))).....))))))).......))))))))))...(((((...))))).(((((((((...............))))))))).)))))...))).))).)))))))))))))))))).....(((......)))...(((((.........)))))..(((((((.(((((.......((((..((((...((((.....(((((..((((((((..((........)).))))))))..))))).....))))..))))..))))......))))).)))))))(((((.((((((..((((...((((((((((((((....)))....((((((.(((...(((((.........))))).))).))))))..........)))))))))))...)).))....)))))))))))((((((((........))))))))....))))..))))))))(((((.......)))))..............((((.((((.((((((......(((....)))...(((((((...)))))))..))))))..)))).))))..((((..(((((....(((((((..(((((((((.((.((((.(((...)))........((((((((((.....)))))))))).............)))).)))))))))))......)))))))...))))).))))))).)))))))..)))))))))))).........))))))))..).)))))))).)))))...)))))......)))((((((((((((((..((((((((((....(((((....))))).....)))))))))).......((((((((((((((((((((((.......(((((((.((((.....)))).........(((((.((((..(((((((......((((((....((.....))....)))))).......))))....)))..))))..))))).........))))))).......)))))(((((....((((..(((((.((((((...((((((((..((((((...........))))))))))))))))))))...)))))..))))....)))))..(((((((((((..........((((.....))))......)))))))))))...)))))))))))))))))...(((((((.((....)).)))))))..........((((((...))))))....)))))).....((((((...((((((...)))))).))))))....((((........))))((((.......))))((((......))))..((((((..((.......))..)))))).)))))))).......)))))))))))))).))...))))))((((...............(((((((((..........))))))))).....)))).....))))).)))))).))))))))))..))))).).)))))))))))))))))...(((((((.......(((((.((((((.((((.(((..........))).)))))))))).)))))(((....((((((.((((((((((.......(((((((..(.....)..)))))))..................((((((((......))))))))(((((.......)))))...(((.(((.............))).)))..)))))))))).))))))......)))..)))))))......((((((((((((..(((....)))..))))))).))))).....)))))))))))))))))))))))))))))))............)))))))))))))))).)))(((.((((((((......((((((((((....(((((((...((((........)))))))))))...)))))))))).(((.......)))((((.........((.((((((......))))))))........))))(((((((.((((((...((....(((((((((..((..........(((..(......)..))))).)))))))))...))........(((((......))))).............(((...((((((..........)))))).)))(((((((..((......))..........(((((.......))))).....(((((((((((((((((((((...((.(((((.....((.(((.(((.((((..(((((((((((.(((((((((..(((((...((((((((((((((((((....)))))..........(((((..................((((((((....))))))))..........((.........)))))))..............(((((((.........)))))))....)))))).)))))))......))))).....))))))))).)))))))))))..)))).))).))).))...))))).))...)))))))))))))))))))))...))))))).(((((......)))))...........))))))...)))...))))...((((..((((.......)))).)))))))))))).))).....(((((((((.........((((((((((..(((((((.((((.((...(((...))).....)).))))(((.((((((.((((....((......))....)))))))))).).))........((((..((((((.((((((((.......((.(((.....))).)).......((((((((((((((.((((.........(((((((.((((((.(((................))).))))))))))))))))).))))))...........))))))))............((((...(((((.....))))).))))))))).)))..))))))...)))))))))))..)))))))).)))))))))))((((.......))))............))))))))...((((((....))))))....................)))))))))).............))))).......))))..((((.((((....((((((((.............))))))))..)))).))))..)))))))))))....)))))))...)))))))....)))))))).........))))))...))))))...))))))))..))...)))))))).)).)))).)))))))))))((((((((....)))))))))))).........)))))).)))))))))))))))....))).)))))).)).))))..)))..)))))).))))))))))))).))))).))).))))))))(((((((.....((((((((.(((.(((.....((.((((.(((((((.((((...........))))))))))))))).))....)))))).))...)))))).....)))))))..)))))))....)))....))))))..)).......(((((((.((....)).)))))))...............((((((((.............))))))))....((((....)))).....((.((.(((((((.(((........))).))))))).))))..))))).))))))...)))))))...)))))))))))).)))).)))).....(((....)))....)))).
Thermodynamic Ensemble Prediction
..((((((((.(..({{((((((((((((...((((((((({{((((((((.((((.((((.(((((...(((.(((((...........(((((((...,,,........,},....)))))))))))).))).,.)))))..)))).))))))))),((({({{{({..((((((....(((....(((((((..((((((((..((((((((..(((((,,(((((((((((((((,{{(({...,,},}.((....}}......,,.({{((((({.........{{....}),,......,}|,.........((((((...))))))((((((((.((((,,.{{((,,,|{{|,,,(((((,(((.((((.((,,,,,,..}}}})),,))}))})}.})))),.})))))))}}))))))))))).,}}}}}}}},,.((((({{.,{|{,,.|,{{,,...,}}}))}}})))))))..,,...,.)))))))))))....((......))......))))))))))...{{{{.,{{,.,,(((((((((((((((..((((.,,...(((((((((......(((.(((((..(((((((((((.........(((((..((((((...(((((.((.(((((.((.(....((((((((.((({....}).)).))))))))..))).))))).)))))))....(((((..((((....)))).,(((((..{{....(((((....((((((((....(((((((((((((.((((((.(((((((....(((((((({.{{.(((((((..(((((.{((({,{.,......||.)))))...)))))...(((((........))))).))))))}..(((((((((.((.......))))),,)))))....({{{((({.((((..(((((....((......(((((....))))).....))...)))))..)))).}))}.....}}}}......)).)))))))))....))))))).))........(((..((({{(((...((.(((((,((..((.(((((((((........))))))))))).,,),,..))))).))..)))))))..))),,,......,,......))))))))),})))))))..)))))))).......}))))......,},..)))))|(((..(((((.........)))))..)))}......))))).....,,(((((((...(((...))))))))))......))))))))))).........)))))))))))..))))))))((((((...((((,(,(((({{..,,,.,,)}}|||.,,...,...)))).)))))).(((((((((...((((((..((((((....((((.{{{...{((((.(.....((((({,(((((((......)))}|.......|.((((((({...})))))))....}))))))))....).))))))}}...((((((((..{,...,,..))))))))......(((((((((((((((((...((((((((.,....(((((....)))))..{((..(((.{(.(((((,.((((((((........)))))))))))))..)}.)))..)))........(((((((..{{{{.........,{{{{{((((({.....(((((((....)))))))....,...})))))))}.,,})))..)))))))((..(((((((({(((((((((.,((((((((.((((((((.((((,((((({.((((.((.(((((((((....(((........))}......................{((....))){((({...,,}|||}}...(((((((((((..((..((.(((....))).))..}}},..})}}},.,)))))))))))))))))).)))}...|}))}}.,.}))).))).))))).}))....))))).,.))).......))))))}..,((.((({.....{{{{.((((......((((((...))))))....,.)))).,{{(((((((,{,.((.,,,..,..}}}}}}}..,,.((((........)))),{{{.{((({{({,{{|||,.....,})))|||{{.,(((..,{{(((,{((((((..((((..,,.((({(((((...))))).})))..}..)).))..)))))))}},..,}}.,})},||||||,...||||||,,},|,|{{|||,,,)))}}}...,.,.}}))}}},.||||,||}.....,{,...,,...,.,,,,|}}},}}))}}}}}.....,|||||....,,,.||||,.......}}||{..,,|}},||}},,..,)}}})|,,,,||||,....|,..,|.{({{........}}}}..{((({(.{((((({,..,...{(..((((((((((((....(((((((((((((((........(((((.........(((((....))))).{{{{.......}}|},......(((((......((((((.....))))))))))).,(((((((((((.(((((((((,.{(((....))))))))))},)).)))))...))))))|{|.....,,,....{(((........))}}...............,((((.....,(((((((((((((...(((((((({(((.....)))}.(((((((((((.....(((((((((((.(((((((((((..((.(((((,...{(((.((((((.,,...(((((.....((({........((((((({{(,(((,{((((((((((...))))))).......))))))).,}}.....)))))))....}))).....)))))(((((((..(((((.....)))))....(((((((.((........)).))))).))....((((((((((.(.((((((((((({,{((((((((....{{,................,,,....}}}}.....}}}}}.,..(((((((((((((((((.....((((.........))))....))))...)).)))))))))))................,,,..((((({.,(((((((((.....,(((((........))))),,((({((..,,|}}})),,..,}|.||,,.,{,{(((((({,..,}}}}}}}.}|,,((((((..({((((({{(,,,{,,({(((({{..{(({...|||||||||||||}.,.||||,.,},}},},,..,,)))),}}.((((.....)))).....{(({(,({{{,..,,.,)}))),)),))),}}}}}}.,.,}))).)))))).,..))))||{.((((((.................,{..(((((.(((((.,((((((((.............)))))))).,.))))).))))}..,,.......(((((((({{{((((.....)))).})}.))))))))))))))...,}}.))))))))))))))).......,(((({(,(,,((((,(({{,,({,..,,..,..}}||,||||..,,||||}}|.,{{{{{|||||{{{{||||||,...((((((((((((((((((....)))))))),..........,{{{.....,}},..})))))))))......,,,,.{{||||,.||}||{{{|||||{|||{{,.,{{{{{..({(((((....(((((.((((...((((.{..(((((((({{{{.{(((({..{(...(((((((.(((((((((....))))))((((((((({((...((((((((((((((.((((((((.{((.,..(((((.........,,}},,...((((((((((......(((((((......(((((((.((,((..((((((.((...(((....)))(((((.....)))))........((((((((,.......{(((((.,,.,((((((((((....(((...}}}...........((((..(((.....))).)))).....{{{{......)))){{{{.....}}}}.{(((...((((((......))))))....)))}.....((((...{{{{...,,,,......))))................})))))))))|||,......,,.......))))))))))))))..)).))))))..}}.)),.))))))).,...))))))).......))))))))))...{((({...))))).(((((((((...............))))))))).)))))...))}.))).)))))))))))))))))),,...(((......)))...{{{{{.,,.....,}}}||,.{((((((.(((((.......((((..((((.,.{(((.....(((((..((((((((..((........)).))))))))..))))).....}))}..))))..))))......))))).))))))}{{{((.{{{{(({.{{{(,..{((({{{{{(((((....)))},..,((({({{{.((((((((.........})))}.}))},})))}}}}}}.,,,.|}))}}})))}...}}.}},,||}},}}})))}}{{{{{(((....,,,,|}}}}))),},.})))},,})))))){((({.......})))}..............((((.((((.((((((...,,.(((....))).,,{((((((...)))))))..))))))..)))).))))..((((..(((((....(((((((..(((((((({{((.((((,(({...}))........((((((((({.....))))))))))..,|......,,.)))).)))))))))))......)))))))...))))).))))))).)))))))..}})))))}}}}).........))))))))..}.)))))))).)))))...))))}.....{{,((((((((({{{{,,..((((((((((....(((((....))))).....)))))))))).......{((((((((((((((((,(({,..,{{{({(((,((,(((........||||||||,.,{((((.{{{{..{((((((,.....((((((....,{.....,,....)))))).....,.))))....}}},,|}}}..))))}.,{{{...,||,|.||,.,,,{({{....}}}...{((((((......)))))}}..{(((({||,...|,|||},.........))))})})))))))}|})))|}}}.}}})),}}))},,.......((((((((((({...,.....{{{{.....))))......})))))))))).,,))))))))))))))))}...(((((((.((....)).)))))))...{{{{{{.((((({...})))))...}))))),,{{,.((((((...((((((...)))))).)))))),}},((((........))))((((.......))))((((......))))..((((((..((.......))..)))))).))))))))},}}},.,.,)),,)}))))},}}},})}|,})}||}}}}}.....}}.}}}}}|||}}|}}}}}},..{{{...,))),.}})))))))),.,,,,,,,,,,,.,,,}}}})))))..))))).).)))))))))))))))))...(((((((.......(((((.(((((,{((((.(((..........))).)))))))))).))))){({,{..((((((.((((((((((..,....(((((((..{.....}..)))))))..................((((((((......)))))))){((({....,,,,}}}}...{{,}|||...{({{......,,,})))..)))))))))).))))))......}}}..)))))))......{(((((((((((..((,....},}..))))))).))))),},..))))))))))))))))))))))))))))))}...........,))))))))))))))))},}){((,(((({(((,,....((((((((((....(((((((...((((........)))))))))))...)))))))))).{(.....,,.,}}||||......},.{{.((((((......))))))}}..{{...{{||,({{{{{{.{(((((...((....{{{{{{||{|.{{..........{((..(......}..))||{{|||||||||{,.||....,,..{{{{,......}}))}............,}||...}))})...)))))))))}..,.....(((((((......,,,{|,....,.....||{{{..,,,,,)}}}}.....(((((((((((((((((((((,..((.(((((.....((.(((.(((.((((..(((((((((((.(((((((((..(((((...((((((((((((((((((....,}})),,,.......{{{{{..................((((((((....)))))))).......,.||{.......,,||...))}}}...........(((((((.........)))))))....}))))).)))))))......))))).....))))))))).)))))))))))..)))).))).))).))...))))).))..,)))))))))))))))))))))..,))))))).{{{{{......))))).......,...))))))...)))..,)))),..((((..((((.......)))).))))))}}))}}.}},.....(((((((((.........((((((((((..(((((((.{(((.((...{{{...,}},....)).}}},{{(.((((((.((((....{{......}}....)))))))))).).)}........((((..((((((.(((((((((.....,{{.{{|.,,..|,|,|,..,....((((((((((((((.((((.........(((((({,((((((.(((.,{{,...,},.....))).))))))))))))))))).))))))...........))))))))..........,,,{{,...{((({.....))))}.,}})))))).)))..))))))...)))))))))))..)))))))).))))))))))),{{{.......)}}}...,,.,,....))))))))...{{{{{{,,,,}||}},.........}},,.......)))))))))}})))..}})))..))))).......))))..{(((.((((....((((((((.............))))))))..)))).))))..)))))))))))....)))))))...)))}}}}...}))))))))....,},.})),)))...}}})},,,.))))))))..))...}))))))).)).)))).)))))))))))((((((((....)))))))))))).........)))))).)))))))))))))))....))),,))))).)).))))..)))..)))))).)))))))),}}}).)))))},)).))))))))(((((((.....(((((({{.(((,(((..,..{|,||||.(((((((.((((...........)))))))))))}}|||},....}))))).}}...)))))).....)))))))..)))))))....)))....))))))..},.......(((((((.({....)),)))))))....{{{{{{.,,,,.{{{{,||,}.,,}}}}}}..||||||||{..,.,,,....)}))}}}}}||.((.(((((((.(((........))).))))))).))}}..))))).}))}))))))))))))...)))))))))))}.))).,)))),....,{{....}},....,})).

Transcripts

ID Sequence Length GC content
GAGGGUUUGAAGUUUCUGUGCUUCAGUGACUGUUACAGAAGAAGAGGUG… 8113 nt 0.3667
Summary

This gene is a member of the semaphorin family and encodes a protein with an Ig-like C2-type (immunoglobulin-like) domain, a PSI domain and a Sema domain. This secreted protein can function as either a chemorepulsive agent, inhibiting axonal outgrowth, or as a chemoattractive agent, stimulating the growth of apical dendrites. In both cases, the protein is vital for normal neuronal pattern development. Increased expression of this protein is associated with schizophrenia and is seen in a variety of human tumor cell lines. Also, aberrant release of this protein is associated with the progression of Alzheimer's disease. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human dermal lymphatic endothelial cells (LECs) identified the SEMA3A as a potential downstream target of the LEC-specific lncRNA LETR1 via Chromatin Isolation by RNA Purification sequencing (ChIRP-Seq) [Ducoli et al. DOI:10.1038/s41467-021-21217-0].