| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGGGUUUGAAGUUUCUGUGCUUCAGUGACUGUUACAGAAGAAGAGGUG… | 8113 nt | 0.3667 |
This gene is a member of the semaphorin family and encodes a protein with an Ig-like C2-type (immunoglobulin-like) domain, a PSI domain and a Sema domain. This secreted protein can function as either a chemorepulsive agent, inhibiting axonal outgrowth, or as a chemoattractive agent, stimulating the growth of apical dendrites. In both cases, the protein is vital for normal neuronal pattern development. Increased expression of this protein is associated with schizophrenia and is seen in a variety of human tumor cell lines. Also, aberrant release of this protein is associated with the progression of Alzheimer's disease. [provided by RefSeq, Jul 2008]
A study in human dermal lymphatic endothelial cells (LECs) identified the SEMA3A as a potential downstream target of the LEC-specific lncRNA LETR1 via Chromatin Isolation by RNA Purification sequencing (ChIRP-Seq) [Ducoli et al. DOI:10.1038/s41467-021-21217-0].