| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGCAACCCGCUCGGGUCCCCUUCCACACUGUGGAAGCUUUGUUCUUUCG… | 4824 nt | 0.5218 |
Enables identical protein binding activity; semaphorin receptor binding activity; and transmembrane signaling receptor activity. Involved in several processes, including positive regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction; regulation of neuron projection development; and regulation of primary metabolic process. Located in microtubule organizing center; nucleoplasm; and plasma membrane. [provided by Alliance of Genome Resources, Jul 2025]
A study in human sepsis patients demonstrated that monocytes were decreased in non-survivors and functioned as key signal transmitters and receivers, with 25 associated signaling pathways identified including the SEMA4 pathway [Liu et al. DOI:10.1590/1414-431X2025e14930].