Basic Information

Symbol
SEMA6B
RNA class
mRNA
Alias
Semaphorin 6B SEM-SEMA-Z SEMA-VIB SemaZ SEMAN Sema Domain, Transmembrane Domain (TM), And Cytoplasmic Domain, (Semaphorin) 6B Semaphorin VIB Semaphorin-6B Semaphorin Z Semaphorin-6Ba Semaphorin-Z SEM-SEMA-Y Sema VIb Sema Z EPM11 SEMAZ
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Cause of death analysis

MANE select

Transcript ID
NM_032108.4
Sequence length
3862.0 nt
GC content
0.6792

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1873.40 kcal/mol
Thermodynamic ensemble
Free energy: -1934.07 kcal/mol
Frequency: 0.0000
Diversity: 1280.04
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((((.(((....))))))))..(((((((((((....((((((....)).))))....(((((.........))))).......(((((.(((((..((((((((((((((.....((((.(((((...))))).....)))).....((((...(((((((.((((.((((.((.......((.((((((((..(..((((((((((...((((.((((((((.......(((((..(((((.((((....((((.((((....)))).)))).)))).))))).)))))...((((.....))))..((((............)))))))))))).)))).((((((...(((((((....(((((..............)))))....)))))))....)))).))((((....(((((...(((.(((.((((((((.(((....(((((.(((((..((((.(((((..((((((((..(.((((.((((((.(...(((..(((((.(((((((....)))))))..))..)))......)))...).)).))))...)))).)...))))))))..)))))))))((((((((((.....))))).)))))....((((((.....(((((..((........))....)))))..(((.(((((((((((((((((..(((((.(((..((.........))...))).)).)))..))))))......))))))))))).)))..((((((((((((.....(((.....((((...((.((((.(((((..((((((..((((((.((((((((.(..(.((((((....((.((....)).))(((((...)))))...((((((((((.(((.((.(((((......(((((((((.(((((((((((....((((..(((.....(((((((.....)))))))....)))))))...))))..(((......)))(((((((.((...)))))))))...))))))).)))))))))...(((.(((((((((((.......(((((....)))))....................((((((((.(((((..(((((((((..(((..(.(((((((.....))))))).)..)))....)))))))).)..)))))...(((((...(((((((.((((((.....(.(((((((.......))))))).)..(((((....((((.(((........((..((((.(((((((....)).)))))))))..)))))))))....))))).)))))).).)))))).))))).))))))))...)))....))))))).).)))(((((..........)))))...))))))).))))))))))))))))))).)..).)))))).))..))))))...)))))).....))))))))).))))))..)))))))))))))))..((((((((((((.(((((((.((((((.(((((.(((((((((((((.((((.(((..((((.(((((((((((....(((.....))).......((((((((.(((....)))))))..)))))))))))))))))))...((((((((..(((((((..(((((((((((((((((.(.(((((((....)))).....(((((((....)))))))((((((((((..(((.((...(((((((((.(((((((((((.((((((....((((((.(((((.((((.......)).)).)))))...))))))(((..(((((((((.(((((((((((.((((..((((((.......((((....(((......)))....))))))))))..)))).))))))..))))))))...)))))).)))))))))))))...((.((...((((...))))...)).))((((((((((.((.(.(((....))).........((((((((...((((.(((((((.((((((..((((...((((((((((((.((((.((((((.(((.(((((((((((..(.((((((((.((((...((...)).)))).)))).)))).)(((.(((((((.((((((((...(((((((((((..(((..((((.((((((...(((((.(((((((((((((((((((..(((.((((((...))))))..)))(((((((((.......(((((..((((..(((....)))..)))))))))(((((((((((.............)))))..)))))).))))..))))).))))))))))((((......))))....))))).))))..)))))..)))))).)))).))))))))))....)))).......)))))..)))..))))))).)))...))))))))))).))).......)))))).))))))))))...((((((((((.......)))))..)).)))....)))))).))))....)))))).))))))).))))....)))).))))))).)))))))))))))))))))))))).)).....)))))..))))))))))...))).).))).))))))).((((((((((.(((......(((((.......))))).))))).))))))))))))))).)))))))..))))))))....(((.((((((................)))))))))))).)))).))))))....(((((((.(((.(((..(((((.(((((.((...((((((((((((......((((((((....(((.(((((((((((((.((((..(((((.((((((((..(((((..((..(((((.((.(((((((..(((((((((((....((((((((((.(((((((.(((((.(((.....))))))))....((((.(((((.......))))).).)))))))))).(((.......))).......((.((((((((.(((((.((((((.(((...)).).)))....)))..))))).))))))))))(((((((...(((((....(((((....)))))....))))).....)))))))...)).)))))))).))))))))((((....))))...........)))))))))))).)))))))))))))))).))).....).))))))))).))))))))).......)))).)))..))))))))(((....)))...(((((((.((((.(.((.(((...))).)).)))))..((((((((..((((...))))..))))))))))))))))))))))))))))).))))).)).))).)))..))).)))))))(((((((.(((.....)))))))))).))))(((......))))))))))).)).)))).))))))).))))(.(((((((((...))))))))).)))))))))))))))..))))).)))))...)))))))..)))).)))..))).)))))....)))).))))...))))))..)..)))))))))))))))).)))).)))))))...)))).))))))....))))))))..).))))..(((((..(((((((.((((((.((((((((.((((((((((.............)))))))((((((((.(.......).)))))))).))))))).)).)).)))))).........((((((.(((((.......))))).))))))))))))).))))).)))))........)))))))))))................................
Thermodynamic Ensemble Prediction
.....(((((.(((....))))))))..(((((((((((....((((((....)).))))....(((((.........)))))...,,..(((((.(((((..(((((((({{{{{,.....((((,{((((...})}}}..,..)))}.,,{.((((...(((((((.((((.((({,({...,{,.((.((((((((.,,,,((((({(((({,,{,{{{(({{({((....{(.,{,||...{(((((((({{{,(({{{{({{,...}))}.|||{{|({,.|...)))))))...((((.....)))).,,(((......}}).,,))))))}))|||.}|||,(,((((,,,(((((((....(((((..,.........,,)))))....)))))))....|||},||((((,,..{{{||,,,{(|,|{,.((((((,,.|||}}}.,(((((({((({(((({.(((((,,((((((,{..(,((((.((,,(({(.,.,,,..|{||}}(((((((....)))))))..|{{{|||{,....|||,{,|.||,|||}...}}}},|...|||||}}}.,}}}}|)))}|,,,{(((((.....))))).|||}},.{{(((,,,.....|||||||||,.......)}...,))))),,{|,.(((((((((((((((((..(((((,(((..,{..,.,,}},),...,,,.}}.)))..))))))......))))))))))).)))}}||||{(({{,||},...||,}}}}}|{{{...{(,(({{.{||||,,||||||},||{(({.,,{{|||,.{.{({((((((.....{{({{{...|,||(((((...)))))..,|||{||{{||,{(({{(.((((({{,{((({{{(((({.(((({{(((((((..,((......)}...,}}.)))))))))))})))))},}}}}))}).})}|}.}}}}}}|.|...}|}|||||.|}}}}),,}})))},|}},||}||{|||||,|||{{{{,,..|}||,|||{,,,.,}}))}||({{{{{||||{|{{{{....,..,......({((((,(((((((,{((((({(((.,|{(,.{,|((((((,,,.,}))})))})}}}},....}|||||||.,{,,||((,(({({(({.,((((((({{((((({.{({(,({{{(((,,,,,..|}||}}}.|,,({{{({{{{{{,{.,||,.,||{.,.{({((({..{{||,}{{(((,{((({{(({(({({,{{}}.},,|||||||||||}||,,.}})))}}))))||}|||,,.,..,)),},||}||||||||||},(((((..........)))))...}}}}}}}.})}}))),)))))))}))}.|..},))))}}.,),})))}})},}))}))),,}..,,,,,))),}))),})),)))}),))))}))},},}|||}|||||||.(((((((,(({{{{.,||||||,,|,|||||||,,}}||}{||}}||||(((((((((((({,,.(((.....))).}.,,..((((((((.(((....)))))))..))))))))))))))))}}}..,((((((({..(((((((.,(((({{(((((((((.{.,,(({(,,((((.((((((,{{(((((((....))))){(((((((((((.,(({,((...(((((((((.(((((((((((.((((((.,..((((((.(((((.{({(,......}},,}.)))))...)))))){|{..(((((((((.(((((((((((.((((..((((((.......((((....(((......)))....})))))))))..)))).))))))..))))))))...)))))).}}})))))))))),,{((.({...((((...))))..,}),))((((((((((.((.{.(((....))).........((((((((...((((.(((((((.((((((..((((...((((((((((({{((((.((((((.(((.(((((((((((..(.((((((((.((((...((...)).)))).)))).)))).)(((.(((((((.((((((((...(((((((((((..(((..((((.((((((...(((({.((((((((((({((((((((.(((.((((((...))))))..)))|||||(((({..,,,.,((((..((((.,(((....))).,}|||||}|,(((((((({{(..,...,,....})))}},.,,)))).,)))}.))))).})))))))),{|||..}}}})}))}..)))))).))))..))))}..)))))).)))).))))))))))....)))).......}))))..)))..))))))).)))...))))))))))).))).......)))))).))))))))))...({((({((((.,.....)))),..))}}))....)))))).)))),,..)))))).))))))).))))....)))).)))),)),)))))))))))))))))))))))).)).....)))}),,)))))))))))}.,)))).)))))).)))).||{|||{{||,{||}..,..(((((,....,.))))).|||||.||))))},}}})))).)))}))),,}}}|||||...,(((,((((((.,.,,,,,,,,,..,,))))))}))||}|)}},|))}.|}||},}}))))})}))}|))),||}}|}(((((.((...((((((((((((,,,...(((((((({,..(((.(((((((((((((.((((..((((({((((((((..(((({,{{(..,(((|{((.{(((((({{(((((((((((....((((((((,,.(({(({{,(((({{(({(,,,,}}}}||}},,,,(({{{(((({.,,,,,.}}))),|.|||}}}})))}|||,}.....}},.,,....{(.((((((((.(((((.,,(({|,|{,,{,|,..,)})...}))},.))))).))))))))))},|||||,.,{{{{{..,.{((((....))))}.,,.)))})}}}}}))),)))}}})).,)))))))}))),,|||((((....))))...,||....{||||,,,,))))})))))))))))))))).)))},...}.))))))))).))))))))).......)))).)))..))))))))|||....}))...(((((((,(((,,(.((.(((...))).)).))))).,(((({(((..{(((...)))}..)))}))))))))))))))))))))))),.}),)))})}.)))}),),..))))})))))))))),|,{{{..((({{{{{||{,,.,,,,)))}).)))))),,}})))).}}.|||,,|||||||,||}|(.((({{{{||,.,)))}}))))}))))),))})}}))),})))))}))))).)}))),)))}})),)})))..)))})))))....)))),)))}.},)))))}..),,)))))))))))))))).)))).)))))))...}))).)))))}....))))))))..},)))}..(((((.,((((((,.((((((.((((((((.(({(((((((.............)))))))((((((((.(.,....,).)))))))).,)))))).)).)).))))))...,.,,,||||{{(,(({{(,..,,,.,}}))},}))}})))))}).))))).))))),},.....)))))))))))................................

Transcripts

ID Sequence Length GC content
AGAAUCCCUGAGCCAGAAGGCCAGGGCAGGGCUGGGGGAUACCCCUGCU… 3862 nt 0.6792
Summary

This gene encodes a member of the semaphorin family, a group of proteins characterized by the presence of a conserved semaphorin (sema) domain. Whereas some semaphorins are transmembrane proteins, others are secreted. Semaphorins play a major role in axon guidance. The protein encoded by this gene may be involved in both peripheral and central nervous system development. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that methamphetamine administration significantly altered cardiac mRNA expression, including the down-regulation of the SEMA6B in microarray analysis, though this change was not statistically validated by subsequent quantitative RT-PCR [Shinone et al. DOI:10.1016/J.Legalmed.2010.01.001]. In pediatric septic shock patients, whole blood RNA sequencing identified two subclasses, and the SEMA6B was noted in discussion as a gene expression marker shared with a prior immunoparalysis subclass study [Yang et al. DOI:10.1186/s13054-023-04689-y].