| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAUCCCUGAGCCAGAAGGCCAGGGCAGGGCUGGGGGAUACCCCUGCU… | 3862 nt | 0.6792 |
This gene encodes a member of the semaphorin family, a group of proteins characterized by the presence of a conserved semaphorin (sema) domain. Whereas some semaphorins are transmembrane proteins, others are secreted. Semaphorins play a major role in axon guidance. The protein encoded by this gene may be involved in both peripheral and central nervous system development. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that methamphetamine administration significantly altered cardiac mRNA expression, including the down-regulation of the SEMA6B in microarray analysis, though this change was not statistically validated by subsequent quantitative RT-PCR [Shinone et al. DOI:10.1016/J.Legalmed.2010.01.001]. In pediatric septic shock patients, whole blood RNA sequencing identified two subclasses, and the SEMA6B was noted in discussion as a gene expression marker shared with a prior immunoparalysis subclass study [Yang et al. DOI:10.1186/s13054-023-04689-y].