Basic Information

Symbol
SEMG2
RNA class
mRNA
Alias
Semenogelin 2 SGII Semenogelin II Semenogelin-2
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Individual identification

MANE select

Transcript ID
NM_003008.3
Sequence length
1978.0 nt
GC content
0.4014

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-421.5 kcal/mol
Thermodynamic ensemble
Free energy: -460.32 kcal/mol
Frequency: 0.0000
Diversity: 469.04
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((((............(((((....(((.((((((((.((.(.(((.(((..(((....))).))).))).).)).)))))))).)))))))).....((((..((((((.(.(((...........))).).))).)))...))))...(((.(((((((........................)))))))..)))((((((.((((.........((.((((.((.((..(((((.(((((((((........))).......((((((...((((........))))...)))))).............((((((((......(((((...((......))...))))).((((.(((....)))...))))))))))))(((((........))))).....(((...((((((((.((((......(((((((.((.((((..(((......))))))).)).)))))))....((((....(((.......)))....)))).((((((((((.....(((.........((.((((...)))).)).......((.((((((..((.((..........)).)).))))))))....(((((.....((.(((....))).))...((((((........)))))).........((......))....(((((((.((.((((.(.....).)))).)).)))))))..))))).......((((.......).))))))....))))))))))...............)))).)))))))))))....................................)))))).))))).....((((((....))).)))...............(((((.......))))).......(((((...)))))....)))).)))))).((((((..((...))..))))))..........)))).))))))(((.(((............))).)))....((((((((..((.((......((((((((........................(((((.......)))))......((((.(((((.((((...(((((((......)))))..))...(.(((((((((..((......))...).)))))).)).)..((((........((((.((.(((((.((((.(((....))).))))....))))).........)).))))..(((((.......))))).)))).)))).))))).))))...((((((((......))))))))...(.((((((((((.((......))..)).)))))).)).)..((((....((.(((........))).))..)))).......))))))))........................(((((.......))))).....))))..)))))))).))))))....((((((.((((.(((((...(((((.((((..........)))).))).)).(((((............((((((.....(((........))).....))))))....((((((..((((...((((....((((((..........((.(((.......))).)).........)))))).....))))....((((((...(((......)))..))))))((((((.((((((..(((..............(((((.....(((.(((.............))).))).....)))))))).)))))).........((((......))))..(((((((.((((((.((..(.(((((.....(((((...)))))))))).)..)).))))((((....)))).....)).))))))).......)))))))))))))))).((((((........)))))))))))..............)))))))))))))))....
Thermodynamic Ensemble Prediction
..,.,{{{{{.,,({{({(({.((({{,,..(((.((((((((.((,(,(((.(({.,({,.,,.}}}.,)),))}.}.)).)))))))).)))})))}.....((((..((((((.(.(((...........))).).))).))}...)))).,,.{,.{((((((........................))))))),,,||{(((((.,,,...........,,{||,.,..{{..(((((.(((((((((........))).......((((((...((((........))))...)))))).........,,.{(((,,,{{......(((((...{{......,,...))))).((((.(((....)))...)))).,|||},,(((((.{,...,,)))))...,|{{{...((((((((.((((......(((((((.((.((((..(((......))))))).)).)))))))......,,..{{{.....,,.,||((((,,{((.((((((((((.....{({...,.....{{||{{(,.,}|||,||,,.....{{,,{{{{,..,{{(({,..,,....},.}}.}|||||,|....||.||,,,,.|{.(({....,}}.,}...((((((........)))))).........((......))....(((((((.((.((((.(.....).)))).)).}))))))..,,,,..,,,.,,{|||,,.....,.}}}},}....)))))))))).)).}.))))).,,.)))).))))))))))}.,,.....,,..,......,,,,,|,.......,,,)))))).))))).||,,{{{(((.,,.||}.,,,..............,(((((..,....||||}..,,,..||||{...|}|}}....,.|}||||{,,.,,,|||.,{{...}},.}}}}}|||.||.....})}}|}}},,.{{{.(((............}}}.}}}....{{{{{{{{..,{.{{..,,..{(((((({..{{................,}..(((((.......)))))..,,,.((((.(((((.((((...(((((((......)))))..))...(.(((((((({..{{......}..,,}.)))))).)).)..((({........((((.((.(((((.((((.(((....))).))))....))))}.........)).))))..(((((.......))))).}}}}.)))).))))).))))...((((((((......))))))))...(.((((((((((.({......)}..))))))))).)).)..||||....{(.(((........))).)}..,},,.......))))))))..,|.........,|||.,.,,..(((((.......)))))..,,.)))),,}))}))}},||||||,...(({({{{({{(.{{{{{...||{||.{{||,,,,,.....)))}.))},||,(((((,....,,.....((((((.....(((........))).....))))))....{(((({..{(({,.,({((,...((((((..........((.(((.......))).)).........)))))).....}}}|....((((((...(((......)))..)))))).{(({{,{{{|||...,,.,,.{{{{{,,...,,,{,....,|||,,{{.,...........))).),),,,..))))||||.}}}}}}...,,....|{((,,,,..}}}}..(({((({.(({{{({(({.{,,(((...,}|,||{|}},)})),,)))},},.}},)))}{{{|...,}))),}},,)).)))))))......}))}))))))))))))).((((((........))))))}}}}}..............)))))))))))}))),...

Transcripts

ID Sequence Length GC content
AAGAUUUUUCAAGCAAGAUGAAGUCCAUCAUCCUCUUUGUCCUUUCCCU… 1978 nt 0.4014
Summary

The secreted protein encoded by this gene is involved in the formation of a gel matrix that encases ejaculated spermatozoa. Proteolysis by the prostate-specific antigen (PSA) breaks down the gel matrix and allows the spermatozoa to move more freely. The encoded protein is found in lesser abundance than a similar semenogelin protein. An antibacterial activity has been found for a antimicrobial peptide isolated from this protein. The genes encoding these two semenogelin proteins are found in a cluster on chromosome 20. [provided by RefSeq, Jan 2015]

Forensic Context

A review of human forensic semen detection notes that the SEMG2 is an mRNA marker for seminal fluid used in body fluid identification [Suttipasit 10.1097/PAF.0000000000000517]. In a subsequent collaborative exercise using targeted mRNA massively parallel sequencing on human dried stains, the SEMG2 was included in the mRNA panel for semen identification and also served as a cSNP marker with two amplicons for donor assignment [Ingold et al. 10.1016/j.fsigen.2019.102208]. A review of forensic proteomics literature notes that the SEMG2 is a protein marker commonly found in seminal fluid and is utilized for body fluid identification in forensic source attribution [Alex et al. DOI:10.1016/j.scijus.2025.101320].