| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGUCCUGAGCUGAACCAAGAAGGAGGAGGGGGUCGGGCCUCCGAGGA… | 3243 nt | 0.5372 |
The protein encoded by this gene is a serine protease inhibitor belonging to the serpin superfamily whose targets include elastase, plasmin, thrombin, trypsin, chymotrypsin, and plasminogen activator. This protein is produced in the liver, the bone marrow, by lymphocytic and monocytic cells in lymphoid tissue, and by the Paneth cells of the gut. Defects in this gene are associated with chronic obstructive pulmonary disease, emphysema, and chronic liver disease. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2020]
A study in rats demonstrated that the SERPINA1 was significantly altered in expression in liver tissue on day 1 following a 20% total body surface area burn injury, where it was classified as an inflammation-related gene and protease inhibitor [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025]. A study in humans demonstrated that changes in the serum isoform distribution of the SERPINA1 were observed following treatment with human growth hormone (hGH) and the GHRH analog CJC-1295, identifying it as a potential biomarker for hGH/GHRH analog administration [Reichel DOI:10.1016/J.Forsciint.2011.07.031].