Basic Information

Symbol
SERPINA1
RNA class
mRNA
Alias
Serpin Family A Member 1 Alpha-1-Antitrypsin AAT Alpha1AT A1AT A1A PI1 PI Serpin Peptidase Inhibitor, Clade A (Alpha-1 Antiproteinase, Antitrypsin), Member 1 Alpha-1 Proteinase Inhibitor Alpha-1 Protease Inhibitor Alpha-1-Antiproteinase Alpha-1 Antitrypsin Anti-Elastase Serpin A1 Serine (Or Cysteine) Proteinase Inhibitor, Clade A (Alpha-1 Antiproteinase, Antitrypsin), Member 1 Serpin Peptidase Inhibitor Clade A (Alpha-1antiproteinase, Antitrypsin) Member 1 Serine (Or Cysteine) Proteinase Inhibitor, Clade A, Member 1 Protease Inhibitor 1 (Anti-Elastase), Alpha-1-Antitrypsin Serpin Peptidase Inhibitor Clade A Member 1 Epididymis Secretory Sperm Binding Protein Protease Inhibitor 1 PRO2275 NNIF
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Other applications

MANE select

Transcript ID
NM_000295.5
Sequence length
3006.0 nt
GC content
0.5306

Transcripts

ID Sequence Length GC content
AGAGUCCUGAGCUGAACCAAGAAGGAGGAGGGGGUCGGGCCUCCGAGGA… 3243 nt 0.5372
Showing 11 to 11 of 11 entries
Summary

The protein encoded by this gene is a serine protease inhibitor belonging to the serpin superfamily whose targets include elastase, plasmin, thrombin, trypsin, chymotrypsin, and plasminogen activator. This protein is produced in the liver, the bone marrow, by lymphocytic and monocytic cells in lymphoid tissue, and by the Paneth cells of the gut. Defects in this gene are associated with chronic obstructive pulmonary disease, emphysema, and chronic liver disease. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2020]

Forensic Context

A study in rats demonstrated that the SERPINA1 was significantly altered in expression in liver tissue on day 1 following a 20% total body surface area burn injury, where it was classified as an inflammation-related gene and protease inhibitor [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025]. A study in humans demonstrated that changes in the serum isoform distribution of the SERPINA1 were observed following treatment with human growth hormone (hGH) and the GHRH analog CJC-1295, identifying it as a potential biomarker for hGH/GHRH analog administration [Reichel DOI:10.1016/J.Forsciint.2011.07.031].