Basic Information

Symbol
SERPINA5
RNA class
mRNA
Alias
Serpin Family A Member 5 PROCI PAI3 Protein C Inhibitor PLANH3 PCI Serine (Or Cysteine) Proteinase Inhibitor, Clade A (Alpha-1 Antiproteinase, Antitrypsin), Member 5 Serpin Peptidase Inhibitor, Clade A (Alpha-1 Antiproteinase, Antitrypsin), Member 5 Acrosomal Serine Protease Inhibitor Plasma Serine Protease Inhibitor PAI-3 Plasminogen Activator Inhibitor III Plasminogen Activator Inhibitor-3 Plasminogen Activator Inhibitor 3 Serpin A5 PCI-B
Location (GRCh38)
Forensic tag(s)
Chronological age estimation

MANE select

Transcript ID
NM_000624.6
Sequence length
2278.0 nt
GC content
0.5149

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-783.90 kcal/mol
Thermodynamic ensemble
Free energy: -825.40 kcal/mol
Frequency: 0.0000
Diversity: 650.41
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((......((((.((.((((((((((((((..((((.(((.......))....(((.((.......)).))).).))))..)))))).)).)))))).)).))))((((...........))))........))))))).........((.(((((((((((((..(((((((.(((((((..(.(((..(((((.(((((.(((....))).).))))((((.(((((((.((((..(((((((((((..........(((((.((.((.((.(((((.(((((((((((.(((((..((.((..(((((.......)))))...))))...)))))...((((..((((....))))..)))).............))))).)))))).)))).)...)))).))))))))))))))).(((((((((((...(((..(.((((((((((((.((((((.((........))...)))))).(((((((((((...((.....)).))))))))))).........((((((..(.((((((...........(((..(((...((((((((((((.(((((((.(((((....(((((....((((....(((((.(((((.((((.((((((((((.....((((((.......)))))).))))).((((((.(((((.((((((((((((((((.(((..((...(((.(((((((........))))).......)))))...))..))).).)))))))))..)))......))).))))).......((((..((......))..))))...))).))).((((......))))..(((((((((..(.((((.((((.(((.(((....(((.((....)).)))(..((.((((((((......(((.....)))(((....((((((((...))))))))..)))..((((((((((((((((((......))))).(((.((((.(((((((((((((....((((((((......)))((.(((((.(((((.((.((((........)))).)).)))))....)))))))..(((((((((((.........)))).))))))).....((((((...)))))))))))....)))))))).....))))))))).))).......(((.(((((((.((((....)))).)))).)))))))))))))))))))))))))))..))..)))).)))...))).).)))))..))))).......))))...)))))))))((((.(((((..(((((((((.((.....)).))))...))))).)))))..))))............)))))..)))))...))))..(((((......)))))...)))))...)))))..)))...)))).))...))))))))))...)))..))))))))).)..))))))...(((((((.......(((...(((((.....((((((......(((.........)))......))))))...(((((...((.((((((....)))..))).))...))))).......)))))...))))))))))((((....)))).......((((((.((((((((((((((..(((((....)))))..))))).(((((.(((((..(((.((.((((....)))))))))..))))......).)))))............((((((.(((((((((((((((((((((((.(((........)))..)).))))))...........((((......))))....)))))).)).))).........((((((((.(((((......))))).))))))))((((((((((........))))))))))))))))))))))))))))).))))))..)))))).......)))))).)..)))))))).))))))........((((((((..(((((.(((.(((.....))).))).))).))..))))))))............((((..................(((((........))))).....((((((((.......((((((((((........))))))))))......)))))))))))))))..))))..))))))).))))...)))...))..))).)..))))))))))).....).))...))))))..)))))))..)).............(((...)))........
Thermodynamic Ensemble Prediction
(((((((......((((.((.((((((((((((((..((((,(((.......)).,,.(((.{(.......)).))).,.))))..)))))).))})))))).)).))))((((.......,...))))........))))))).....{{,.({.(((((((((((((..{(,((((.(((((((..{.(((..((,,(((,,((.(((,,,,|||{|{|||{((((.{{{{{{{.{{||,.{{,{{{{{((({((.(((((,({({(((((((.(((...(({(((|{{{{.{{{((|{({,.,,.,..|{{||,.....,))}}),.},}))}}})))))}}}||||..((((....))))..,,,}.))))),))}}}},.,.((((((..(((......)))..)))))).)))))))))}{((((((((((...(((..(.((((((((((((.((((((.((........))...)))))).(((((((((((...((....,)}.))))))))))).........((((((..(.(((((({{...((((.{((({{((({.{((({(,,(((((,,,,{||}}|,||,(((((((((...,{{{((,,.{(((({((,,{{(((({{(((,{((((.....((((((.......)))))).))))),|)|((({(({{{{(.,,,.,||,||,|||}||,..((...(({,(((((((........))))).......)))))...))..)))}).))),}))))}}}}..,}}}.|||,|||,...|||..((((..((......))..))))..,|||,{...||||......,}}}..|||.|||,({{(.,{{({(({(,(({.{{{.{(,{{,.{{..,.)).}),,}})}}|,.,||}|,},}}}},}..},}))))))))).((((((((...)))))))).}))).}|||,{{((((,(((((((((((({.{{|..(,,.,,,|.|,|||||,|||||}}}}||,||||{......}||{({(((((,(({{,.,{.(((((.....|,|||},|}.}}|||,,..,|||||...(((((((((((,(....)}.)))).))))))).....((((({...}))))).,,,,..{{|||}||||{{{,.{||||||||.,.,,}.))}}}|}((((((((.((((....)))).)))).)))),||||,,,,))))),))))))))}}}....)))}),,,}})),,)}))}))}.}||||{,.....}}}}..||||}}}}},{|||,{((((..(((((((((.((.....)).))))...))))).))))}..}))),,......,,}},}}}|||}}}}...,.,,.(((((((((((((||{|.{{{.,,,)}}.})}.,..)))))))))))),...,,,,,)))))}.})))..))})))))).}..)))))).,.({((({{...,,,.(((,.,({{{{,....((((((,{.,..,,,.........,}},.}}}.})))))..{((({{,..(({,,.,,,.}}})))..,))})}..,|||,,...}}}}))}}},,,}}}))))))),{{{....,}}},,.....((((((.((((((((((((((.{(((((....)))))}}))))).,(({,{{((((..(((.((.((((....)))))))))..))))..|}|,,.|}}}},...,|......((((((.((((((((((,,((,((((((((.(((........)))..)).))))))},,.....,{,(((({,.,,.||},..,,}},|{|.{{{{,,.....}}}},|||,((({(,,(({{{{{{|,,,..))))))))}|))}|.|||))}}}.}}})))))))))}...))))))))))))))).))))))..)))))).......)))))).)..)))))))).)))))}.,......((((((((..{,(((.(((.(((.....))).))).))).}}..))))))))...{{{,,..},((({,{,..,,.....||....{{{{{........))))),....((((((((.......((((((((((........))))))))))..}}..))))))))}))))}}},)))}..}}})))),))))...)))...))..))).,..)))))))))))....,}......))))))..}))))))..)),............(({...}))........

Transcripts

ID Sequence Length GC content
CUCUGCCCUUUCUGAGCCCGAGGGACUGCCACCUCCACUGUGUGCACAC… 2278 nt 0.5149
Summary

The protein encoded by this gene is a member of the serpin family of proteins, a group of proteins that inhibit serine proteases. This gene is one in a cluster of serpin genes located on the q arm of chromosome 14. This family member is a glycoprotein that can inhibit several serine proteases, including protein C and various plasminogen activators and kallikreins, and it thus plays diverse roles in hemostasis and thrombosis in multiple organs. [provided by RefSeq, Aug 2012]

Forensic Context

A review of human multi-omics studies for biological age estimation, which synthesizes findings from various cited works, notes that the SERPINA5 is a proteomic aging biomarker identified as having higher abundance in the age-dependent urine proteome of healthy men [Solovev et al. DOI:10.1016/j.mad.2019.111192].