| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCUGCCCUUUCUGAGCCCGAGGGACUGCCACCUCCACUGUGUGCACAC… | 2278 nt | 0.5149 |
The protein encoded by this gene is a member of the serpin family of proteins, a group of proteins that inhibit serine proteases. This gene is one in a cluster of serpin genes located on the q arm of chromosome 14. This family member is a glycoprotein that can inhibit several serine proteases, including protein C and various plasminogen activators and kallikreins, and it thus plays diverse roles in hemostasis and thrombosis in multiple organs. [provided by RefSeq, Aug 2012]
A review of human multi-omics studies for biological age estimation, which synthesizes findings from various cited works, notes that the SERPINA5 is a proteomic aging biomarker identified as having higher abundance in the age-dependent urine proteome of healthy men [Solovev et al. DOI:10.1016/j.mad.2019.111192].