| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCUGACCUCGCACCCAGCUCGGAGCCCGGAGCGUGCCUCGGCGGCCUGU… | 2476 nt | 0.4342 |
The protein encoded by this gene is a member of the serpin family of proteinase inhibitors. Members of this family maintain homeostasis by neutralizing overexpressed proteinase activity through their function as suicide substrates. This protein inhibits the neutrophil-derived proteinases neutrophil elastase, cathepsin G, and proteinase-3 and thus protects tissues from damage at inflammatory sites. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
A study in humans demonstrated that SERPINB1 is an OUD-specific hub gene in the dorsolateral prefrontal cortex co-expression network, implicating it as an inflammatory regulator in opioid use disorder [Seney et al. DOI:10.1016/j.biopsych.2021.06.007]. Research in mice showed that Serpinb1 mRNA expression increased in whole blood monocytes from animals with brain injury following clodronate pre-treatment, where it functions as a neutrophil elastase inhibitor associated with an anti-inflammatory phenotype [Gudenschwager Basso et al. DOI:10.1186/s12974-024-03032-8].