Basic Information

Symbol
SERPINB1
RNA class
mRNA
Alias
Serpin Family B Member 1 MNEI PI2 LEI EI Leukocyte Elastase Inhibitor ELANH2 Serine (Or Cysteine) Proteinase Inhibitor, Clade B (Ovalbumin), Member 1 Serpin Peptidase Inhibitor, Clade B (Ovalbumin), Member 1 Monocyte/Neutrophil Elastase Inhibitor Peptidase Inhibitor 2 M/NEI PI-2 Protease Inhibitor 2 (Anti-Elastase), Monocyte/Neutrophil Derived Epididymis Secretory Protein Li 27 Epididymis Luminal Protein 57 Anti-Elastase Serpin B1 HEL-S-27 HEL57
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Mechanical injury analysis

MANE select

Transcript ID
NM_030666.4
Sequence length
2476.0 nt
GC content
0.4342

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-746.50 kcal/mol
Thermodynamic ensemble
Free energy: -794.17 kcal/mol
Frequency: 0.0000
Diversity: 430.98
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((((((.((((((((.(....).)))).(((((((((.((((((.(((....))))))).)).))))))....)))....(((((...((((((((...(((...(((((((((.((((((..((.((..(((((........(((((((....((((.......))))...(((.(((((((....)))))))..))).....((((((...))))))..((((.((((((((((((...))))))((.(((((((((.((((....))))))))))..))).)).......)))))).))))((((.((((...........)))).)))).)))))))..........)))))..)).))))))))...))))))(((((((((((((((.((((((((((((((((((((....(..(((..(((((((((((((((((.((((...........))))((((((.(((.((((((((((.....((((..(.((((....(((((((((........)))))......)))).......)))).)..)))).(((((((..(((((((.((((.(((((..((((.......(((((...))))).....(((((((...(((((((((.(((..............)))............(((((((((.((...(((...)))..)))))))))))(((..........)))((((((((((((...((..(((((((.......)))))))..))(((...(((((((..((((((((..(((((.....)))))..)))))).......))....)))))))...)))(((...)))((((((...))))))..((((.....(((..(((((....((((.((((((...))))))...)))).((((((((.....)).))).))).(((((((((((((..((.((.((.((((((((((.(((((((((.....(((((....)))))........(((((((.....)))))))..(((((((((((((((..((((((((((.(((....)))(((((((((......))).....)))))).(((......))).)))))).)).))..)))))..)))))))))).........(((((((((.......((((.((((((......))))))..))))...((((((((.(((..............))))))).)))).)))))))))...(((((((((((((.....((((((..............((...((((....)))).)).............)))))).)))))))))))))...........((.((((((..((((.((..(((.((((((((((((((.((((...............(((........))))))))))))))))))))).)))......)).))))..)))))).))...((((((((((.......)))))))))).)))))))))))).((.((((..(((((......)))))...)))).))......((((((.......))))))))))))))))).))))))))))))))).................(((((((...(((......)))...))))))))))))..)))......))))))))..))))))))...))))))))).))))))).(((((((....)))))))............(((((((((((((((((..((((((.....(((....)))......)))))).)))..((((((((((((...)))))).(((((((......)))))))...))))))..((((((((.......)))))))))))))))))..)))))...((.(((((.......)))))))......((((........))))..))))))))).)))))))))))..))))))))))))))))).))).))))))............((((((((...))))))))..((((((((..(((((.((.(..((((((((((....(((.....)))(((..(((((.((((((.....)))))).)))))...))).))))))))))...).)))))))..)..)))))))....))))))))))))))).))..)))..)....)))))))))))))))..(((((.((.(.((((....)))).).)).).).)))))))).(((((......)))))...((((((((......))))))))......))))))))))))))).....)))...))).))))))))...)))))....))))))))))(((((((((((((((........))))).....((((((......))))))(((..(.((((.((((((((......)))))))))))))..)))..............)))).))))....))......
Thermodynamic Ensemble Prediction
.....((((((,((({((((,(...,},}}}},{({((((((.((((((.(((....))))))).)).)))))),.,.}}.....(((((...((((((((...({{...{{(((((({{((((((..((.((..(((((........(((((((....((((.......}}}}..,(((.(((((({,,,,|}}}))),,))}..,..((((((...))))}).{((((.((((((,{{,,{...|||||}{,{{,.(((((,,((({....}))))))))),}..}.)),,}....)))))).))))},,{.{{||,,,...,,,..,})}.,,},.)))))))..........)))))..)).))))))))}..))))))(((((((((((((((.(((({((((((((({(((((....{..(((..(((((((((((((((((.((((((......))})}))((((((.(((.((((((((({.....((((..(.((((.,{.(((((((((........)))),.....})))).,.....)))).)..)))),(((((((..(((((((.((((.(((({.,((((.......(((((...))))).....(((((((...(((((((((.{{,..,..........,)),............(((((((((.((...{{{...}}}..))))))))))){((..........}}}((((((((((((...((..(((((((.......)))))))..))(((...(((((((,.,(((,((,..,,||,}}}..)}|}},{||||,,.,,}}},))....)))))))...)))(((...}}}((((((...))))))..((((..{..(((..(((((....{(((.((((((...))))))...)))}.((((((((.....)).))).))).(((((((((((((..{,,((.((.((((((((((.(((((((((.....(((((....)))))........(((((((,...,))))))).,{((((((((((((((..(((((((((({(((....))}(((((((((.......},.,},,)))))).(({,.....))).)))))).)).))..)))))..)))))))))},}.......(((((((({..,,,,.((((.((((((,...,,})))))..}))),,,,||,,.((((....}})}......{(((.....))))..}))))))))...,{(((((((((((.....((((((...........,,,,..,,((({....}))}.)}.,}..........)))))).)))))))))))}|.,,....,,.,((.((((((..(((({(((((((.((((((((((((((.((((......,,....,,.{((........))})))))))))))))))))).))},)},..)).))))..)))))).))...((((((((((.......)))))))))).)))))))))))),{(.{(((,.{((((......))))}.,.)))).))......((((((.......))))))))))))))),))))))))))))))))).{{{.....,,......(((((((...(((......)))...))))))))))))..)))...,..))))))))..))))))))...))))))))).))))))).(((((((....)))))))...{{,......|{((,((((((((({{(..((((((.....(((....)))......)))))).})}..((((((((((((...}))))).(((((((,....,)))))))...})))))..((((((((.......))))))))))))))))).,}},,,...{{.(((((.......)))))})......((({........))))..))))))))).)))))))))))..))))))))))))))))).))).)))))}............((((((((...))))))))..((((((((,.(((((,((.(..((((((((((....(((.....))){((..(((((.((((((.....)))))).))))}...))).))))))))))...).)))))))..),,)))))))....))))))))))))))).))..)))..}....)))))})))))))))..((({{,(,.{.((((....)))).}.},,}.}.)))))))).(((((......)))))...((((((((......))))))))......,)))))))))))))).....))}...))).)))))))).,.))))),,,.)))))))))){{((({(((((((((........))))).....((((((......)))))){{{...{(({(.((((((((......))))))))}))))}.}}}..............)))).))))....,,......

Transcripts

ID Sequence Length GC content
CCUGACCUCGCACCCAGCUCGGAGCCCGGAGCGUGCCUCGGCGGCCUGU… 2476 nt 0.4342
Summary

The protein encoded by this gene is a member of the serpin family of proteinase inhibitors. Members of this family maintain homeostasis by neutralizing overexpressed proteinase activity through their function as suicide substrates. This protein inhibits the neutrophil-derived proteinases neutrophil elastase, cathepsin G, and proteinase-3 and thus protects tissues from damage at inflammatory sites. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]

Forensic Context

A study in humans demonstrated that SERPINB1 is an OUD-specific hub gene in the dorsolateral prefrontal cortex co-expression network, implicating it as an inflammatory regulator in opioid use disorder [Seney et al. DOI:10.1016/j.biopsych.2021.06.007]. Research in mice showed that Serpinb1 mRNA expression increased in whole blood monocytes from animals with brain injury following clodronate pre-treatment, where it functions as a neutrophil elastase inhibitor associated with an anti-inflammatory phenotype [Gudenschwager Basso et al. DOI:10.1186/s12974-024-03032-8].