| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACACACAUAGCCUCUCUGCCCACCUCUGCUUCCUCUAGGAACACAGG… | 1707 nt | 0.3937 |
Enables cysteine-type endopeptidase inhibitor activity; protease binding activity; and virus receptor activity. Involved in several processes, including autocrine signaling; paracrine signaling; and regulation of protein metabolic process. Located in several cellular components, including cytoplasmic vesicle; cytosol; and extracellular exosome. [provided by Alliance of Genome Resources, Jul 2025]
A study in human body fluids demonstrated that the SERPINB3 is a vaginal secretion biomarker with detectable cross-reactivity in saliva, and its inclusion of circular RNA transcripts does not impair specificity [Liu et al. DOI:10.1007/s00414-019-02027-y]. A separate study in human prostate tissue found the SERPINB3 is upregulated in samples with a high postmortem interval, where it is involved in enzyme and protease binding molecular functions [Javan et al. DOI:10.1038/s41598-025-29561-7].