Basic Information

Symbol
SERPINB3
RNA class
mRNA
Alias
Serpin Family B Member 3 Squamous Cell Carcinoma Antigen 1 HsT1196 SCCA1 T4-A Serine (Or Cysteine) Proteinase Inhibitor, Clade B (Ovalbumin), Member 3 Serpin Peptidase Inhibitor, Clade B (Ovalbumin), Member 3 Protein T4-A Serpin B3 SCCA-1 SCC SCCA-PD SSCA1 SCCA
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Postmortem interval inference

MANE select

Transcript ID
NM_006919.3
Sequence length
1707.0 nt
GC content
0.3937

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-408.2 kcal/mol
Thermodynamic ensemble
Free energy: -441.6 kcal/mol
Frequency: 0.0000
Diversity: 425.86
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..............((((((((((((((((((((((((.(((((......)))))..........(((((((...)))))))(((..(((.......)))..)))...(((((((.((((....)))).))......((....)))))))...(((((((((.((((.(((((.(((.((..(((((((((((((((((...)))).))..........(((.....)))........(((..(((.((.((((...)))).)).))).))).(((......)))..........((((((..((((((((.........................))))))))....)))))).)))).))))))))).))))))))((((.((..((((((((....))).......(((((((................)))))))..................(((((((((((..((..((((((((.((.....(((((.((..((((.......))))..)).))))))).))))))))..))...............((((.........))))..(((((....)))))))))))))))))))))....)).)))).......)))).))))))))).........................)))))))...(((((......))))).............(((....)))..(((((((................))))))))).))))).))....)))((((.(.(((((...(((((.....((((..(((.(((......))).)))..))))...........))))).))))).).)))).)))))...((((((.......(((((((...((((((.(((((.(((....((((((((..(((((..((((.(((((((....))...)))))((((((((.(((((.(((((.(...).)))))..(((.(((((((((((((((.((((((((((..((((((......((((((((((.(...).)))))..)))))(((((.((((((((.....(((((....)))))(((((.((.((.(((..........))).)).)).))))))))))))))))))...............((.(((((((((......................))))))))).)).................(((......(((((((..(((....))).)))))))))).....))))))..)))))))..))).)))))))))......(((((((((((.....))))))).))))....)))))).))).))))).)))))))).......((((((((((((...))))))))))))............)))).)))))..))))))))....)))...)))))..((((....))))..(((((((((.((..........)).))))))))))))))).........(((((((..(((..........(((((((((((..........(((((.(....((((.....))))....))))))...........))))))))))).....((((((((..((......)).((((((((...))))))))........)))))))).)))..)))))))............)))))))....))))))..........
Thermodynamic Ensemble Prediction
.............(((.((((((..{{{{({((({(((.(((((......)))))}}|.......(((((({...})))))).,,..|{|},,,...|,,..,}},,.{,{((((.((((....)))).)).}},.......,||||,...,.||||,{{{{,(,,,.(((((.(((.{,..(((((((((((((((((...)))).))..........(((.....)))........{(({{({,.((.((({...)))).})}))),,},.(((......)))..........((((((..((((((((..,...........|,,.....},,))))))))....)))))).}))).))))))),,.))))))))(((,.{{......,{{{....))).......((({{{{..,.,...,}}},,..})))))}......{{,,,(((((.((((((((((((..,,,(((((((((.((....,{((((.((..((((.......))))..)).))))))).)))))))},}},.,.............((((.........))))..(((((....))))))))))))))}})).))))).....,,,,,,,,...)))))).)))||{{,..,{{{,,...(((((((((...,{{{{{,..,((((({{{...},,,,......,,..{(((,,.{{{....{(((((((................)))))))}}}},,}}}}}},,,}}}|}||)|.(((((...(((((.....((((,.(((..||,.,.,.,)),))),,)}}).........,,})))).))))).,({|{{{{{{{{,,,|||,,||}}}},.||||||,..,|||||,.|||||,||,....((((((((..(((((..,{{{.(((((((....))...)))))((((((((.(((((.(((((.{...).)))))..(((.(((((((((((((((.((((((((((.,((((((.,..,.((((((((((.{...}.))))}..))))},{{{||{{{((({(,,,,,{{{{|||||,}))}|{|||,((,((.{((.,......|.|)).)}.)),))))}))}||}}}}|}},.....,,,..,....{{.(((((((((......{........,......))))))))).}),,.......,.,,....||,|},,,.{((((((..(((....))).)))))))}}}.....)))))},,))))))).,))}.)))))))))....,.(((((((((((.....))))))).)))).}..)))))).))).))))).)))))))).......((((((((((((...))))))))))))............))}}.)))))..)))))))),))))))}..}})))..((((....})))..{(((((({{.{(,,....,,}.}}.)))))})}}.})}}....,{{{..,...,,}}}}.....)))))))))..{{|||||,,....,}}}{{{{({{...{(((({{.{{||,.......,||,,,.....,,..,,}||||||||.,,..{(((({,,....,,,,,..|.((((((((...)))))))).,,,,,,||))},)}}.,|||{|||||},...........}))),,,)}}}}))),),)}}},.....

Transcripts

ID Sequence Length GC content
AGACACACAUAGCCUCUCUGCCCACCUCUGCUUCCUCUAGGAACACAGG… 1707 nt 0.3937
Summary

Enables cysteine-type endopeptidase inhibitor activity; protease binding activity; and virus receptor activity. Involved in several processes, including autocrine signaling; paracrine signaling; and regulation of protein metabolic process. Located in several cellular components, including cytoplasmic vesicle; cytosol; and extracellular exosome. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in human body fluids demonstrated that the SERPINB3 is a vaginal secretion biomarker with detectable cross-reactivity in saliva, and its inclusion of circular RNA transcripts does not impair specificity [Liu et al. DOI:10.1007/s00414-019-02027-y]. A separate study in human prostate tissue found the SERPINB3 is upregulated in samples with a high postmortem interval, where it is involved in enzyme and protease binding molecular functions [Javan et al. DOI:10.1038/s41598-025-29561-7].