| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGGAGUCCGCGGCGAGCGCAGCAGCAGGGCCGGGUCCUGCGCCUCGGGG… | 4143 nt | 0.4352 |
This gene encodes a member of the serine protease inhibitor family which are also known as serpins. The encoded protein belongs to a subfamily of intracellular serpins. This protein inhibits the activity of the effector molecule granzyme B. Overexpression of this protein may prevent cytotoxic T-lymphocytes from eliminating certain tumor cells. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Mar 2012]
A study in mice demonstrated that SERPINB9 was upregulated in spleen leukocytes as part of a common early transcriptional response across three models of systemic inflammation (trauma/hemorrhage, burn injury, and LPS infusion) [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005].