| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCUCUGAAGCGCCACUUCUCAGAAACACAGAGCUUUAGCUCCGCCAAA… | 2203 nt | 0.4943 |
This gene belongs to the serpin gene superfamily. Serpins play roles in many processes including inflammation, blood clotting, and cancer metastasis. Members of this family have highly conserved secondary structures with a reactive center loop that interacts with the protease active site to inhibit protease activity. This gene encodes a plasma serine protease that functions as a thrombin and chymotrypsin inhibitor. The protein is activated by heparin, dermatan sulfate, and glycosaminoglycans. Allelic variations in this gene are associated with heparin cofactor II deficiency. [provided by RefSeq, Jul 2015]
A study in humans demonstrated that the SERPIND1 is down-regulated in the plasma of patients with alcohol-associated hepatitis, correlating with disease severity and hepatocellular failure as part of a broader plasma protein signature reflecting impaired hepatocyte nuclear factor activity [Argemi et al. DOI:10.1016/J.Ajpath.2022.08.009].