Basic Information

Symbol
SERPIND1
RNA class
mRNA
Alias
Serpin Family D Member 1 HLS2 Heparin Cofactor 2 D22S673 HC-II HCF2 HC2 Serine (Or Cysteine) Proteinase Inhibitor, Clade D (Heparin Cofactor), Member 1 Serpin Peptidase Inhibitor, Clade D (Heparin Cofactor), Member 1 Protease Inhibitor Leuserpin-2 Heparin Cofactor II Serpin D1 Leuserpin 2 THPH10 HCII LS2
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_000185.4
Sequence length
2203.0 nt
GC content
0.4943

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-675.20 kcal/mol
Thermodynamic ensemble
Free energy: -713.90 kcal/mol
Frequency: 0.0000
Diversity: 634.88
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((..((((.....))))..)))..(((((.(((((.((((((((..(((((.....)))))..(((((..........................)))))..))).))))).))))).((.(((.((((((.......((((((((...(((((((.((((...((((....))))))))...............)))))))..((((((((((((......((((....)))).....(((.....))).((((...))))))))))))))))....(((.......(((((((.(((....)))...(..((((((((.....)))...)))))..)((((((((.........))))))))..(((((((((((((((.......(((.((((((.......)))))).)))))))))).))).)))))...(((.....)))..((((((.((((....))).).)))))).))))))).......)))........((((((......(((((((((.........((((((.(..(((((((.......))))))).)))))))....(((((((........))))))).............)))))))))......)))))).................))))))))...)))))).))).))(((((...))))).......(((((((((((.(((((.....)))))...........((((((.........))))))............(((((((.......)))))))((((((((.(((....((((....))))...))).((((((......................)))))).(((((.(((((((......((((((....((((((.......(((.....)))......))))))....)))))).......))).)))).)))))....((((...(((((..(((.......((((...(((((((((...(((.((...((((((..(((((((((..(((.......(((((...)))))...))).)))....)))))).))))))....))))))))))))))...))))((((..((((..(((...(((.(((((((.(((...))).))))).......)).)))...))).))))..))))((((((((((((((.((((...((((((..(.............)..)))))).))))...((((..((((((............)))))).))))..((..(((.(((((((.(((((.((((((((.....)))))))).......((((((.((((((....(((((.((((((((((((.........((((..((.((((((((((.(.((..((((....((((.(((((((....)))))))))))..))))(((.........))))).))))))))).)).))..)))).(((((((.(((....(((((..(((.....))).)))))...))))))))))(((......)))))))))).....))))).)))))....)))))).))))))(((((.(((((((((...(((((.((((......(.((((((....)))))).)..........(((((....)))))......))))..)))))....))))).(((((.(((((..((((((.(((.....))).))))..))..)))))....(((((....)))))..(((((.......(((((......))))).((.((((((.....((((((..........)).))))..)))))).)).)))))...((.......)).......))))))))).)))))..........)))))))))))))))..))..))))))))))..))))....((((...........))))...(((((((((...........((((.((((...))))))))........))))))))).....((((((((.....(((.(((((.......)))))))).))))))))....((((((.(((..........)))))))))...)))..)))))...))))))).))))).(((((....(((((......)))))..))))).))))))))))).((((((........))))))..(((((((....))))))))))))
Thermodynamic Ensemble Prediction
.{{(,,((((.....))}).,)))..(((((.(((((.((((((({..(((((.....)))))..{{(((..........................})})),,))}|}}))).})))).(({(((,(({{{(,{{{...({{(((((,,{(((((((.((((...((((....))))))))...............))))))}.{((((((((((((...,,.{(((....}}}}....,|(({......)}||||...)},})))))))))))).},.{({...,,,.{{{((((.,,{....))).,,...{{((((((,,...|||,,.}})))},.||||{|||.|,,,,,},}})}}})),,|((((((({((((((.......{||,||{{||.},,,{,,,}})),}))))))))).)))..)}))...,{{.....}}}..((((((.((((....))).).)))))).}}}}|||.......,,|,.....,,{(((({..,,{,(((((((((...,,,{,|({((({.,..{{{{{{{.,,,,,,|}|||||{||}}}||,,..(((((((........))))))}....,,.,,{||.,}}||}}}}.},,..}}})}}..........,}}},..))))))))...|||||}.||}.}|(((({.,.|}}}},....,,(((({{{((((.(((((.....)))))......,,,,||{((((,.,||,.|||||}||,,,,,......,{{{{{{{...,,,.}}}))})},{(((({,(,{...,||{{....)))).,.,,{,{(((((......................})))))}{{{{{.,||||||,,....((((((....((((((.,,....(((.....)))....,,))))))....)))))).......})).}}||,||}},.......}}}}|{|||,.||.....,..||||...{((({{(({...{{{.{{,.,|{{||{..{{{{{{{||,.|||}},,,..(((({...))))),|{|,..,}}..,,)))}))}))))))..,.}||||||}}}}}}},,,|,||(((({{,((({,{(({..(((,(((((((.(({...})).)))))}.....,||.}},,},}...}}}},.}|}}|||||{|((({{((,((({...,{{({({.,...,,,,,,....,..)})}})|}}||{,.,.{{,.{((|((||||........}||}||{|||}..|({,{({,(((((((.(((((.((((((((.....))))))))....,,{((((((.((((((,...(((((.((((((((((((,........((((..((.((((((((((.(.(({.((((....((((.(((((((....)))))))))))..)))),{{.........,}))).})))))))).)).))..)))}.(((((((.(((..,.(((((..(((.....))).))))),..)))))))))),((......}})))))))).....))))).)))))..,.)))))).)))))){((((.((((|{{,..,{(((,,......}}}},{.((((((....)))))).}..{{{.....(((((....))))).....})),,..}}})),...,}|,((((.((((((..,{(.{,,,,(((,{.{{|||{||||,.....,}}}}.,,,{{|||,...|||}}..{{{,,..,..,.{,{,({{{{.{|||,,...)}||,||}}}...((((,.....}}}),}..}}}),,}}}|},....}}})).},}})).)))))).)))).,},,,.)))).))))).....}}...))))))))))))))),,.),,}}}))))))}},||||((({((((...........)))}...(((((((({...........((((.((((...))))))))...,,.,,))))))))).,.,,((({((((.....{{{.{||{{.,,,,,.)))))))),}))})))}....||||||||{{.......,..})))))))}.,,,,.....,.{((((.....))))}.,,,,,,,}}}}},})}}}}}}})))}))})))))}))))))))))).((((((........))))))..(((((((....))))))))))))

Transcripts

ID Sequence Length GC content
AUCUCUGAAGCGCCACUUCUCAGAAACACAGAGCUUUAGCUCCGCCAAA… 2203 nt 0.4943
Summary

This gene belongs to the serpin gene superfamily. Serpins play roles in many processes including inflammation, blood clotting, and cancer metastasis. Members of this family have highly conserved secondary structures with a reactive center loop that interacts with the protease active site to inhibit protease activity. This gene encodes a plasma serine protease that functions as a thrombin and chymotrypsin inhibitor. The protein is activated by heparin, dermatan sulfate, and glycosaminoglycans. Allelic variations in this gene are associated with heparin cofactor II deficiency. [provided by RefSeq, Jul 2015]

Forensic Context

A study in humans demonstrated that the SERPIND1 is down-regulated in the plasma of patients with alcohol-associated hepatitis, correlating with disease severity and hepatocellular failure as part of a broader plasma protein signature reflecting impaired hepatocyte nuclear factor activity [Argemi et al. DOI:10.1016/J.Ajpath.2022.08.009].