| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGCUGUGUUUGGCUGCAGGGCCAAGAGCGCUGUCAAGAAGACCCACA… | 3171 nt | 0.5156 | |
| ACAGCUGUGUUUGGCUGCAGGGCCAAGAGCGCUGUCAAGAAGACCCACA… | 3180 nt | 0.5167 |
This gene encodes a member of the serine proteinase inhibitor (serpin) superfamily. This member is the principal inhibitor of tissue plasminogen activator (tPA) and urokinase (uPA), and hence is an inhibitor of fibrinolysis. The protein also functions as a component of innate antiviral immunity. Defects in this gene are the cause of plasminogen activator inhibitor-1 deficiency (PAI-1 deficiency), and high concentrations of the gene product are associated with thrombophilia. [provided by RefSeq, Aug 2020]
A study in human prostate tissue demonstrated that the SERPINE1 is upregulated in samples with a high postmortem interval (PMI) and is involved in enzyme and protease binding molecular functions [Javan et al. DOI:10.1038/s41598-025-29561-7]. In rhesus macaques, the SERPINE1 was identified as a differentially expressed gene upregulated in animals with hypertrophic cardiomyopathy [Rivas et al. DOI:10.1038/s41598-024-82770-4]. A study in rats demonstrated that the SERPINE1 mRNA expression was significantly increased in skin incision wound tissue at 1 and 3 days post-wounding, and its protein was localized to endothelial cells, fibroblasts, and leukocytes at the wound site [Kameyama et al. DOI:10.1016/J.Legalmed.2015.02.007]. In pediatric septic shock patients, plasma levels of the SERPINE1 were significantly elevated in a subclass characterized by worse clinical outcomes, innate immune upregulation, and endothelial injury [Yang et al. DOI:10.1186/s13054-023-04689-y].