Basic Information

Symbol
SERPINE1
RNA class
mRNA
Alias
Serpin Family E Member 1 PAI PLANH1 PAI1 Serine (Or Cysteine) Proteinase Inhibitor, Clade E (Nexin, Plasminogen Activator Inhibitor Type 1), Member 1 Endothelial Plasminogen Activator Inhibitor Plasminogen Activator Inhibitor 1 Serpin E1 PAI-1 Serpin Peptidase Inhibitor, Clade E (Nexin, Plasminogen Activator Inhibitor Type 1), Member 1 Plasminogen Activator Inhibitor, Type I
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference Sudden cardiac death diagnosis Wound age identification Cause of death analysis

MANE select

Transcript ID
NM_000602.5
Sequence length
3156.0 nt
GC content
0.5152

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1108.30 kcal/mol
Thermodynamic ensemble
Free energy: -1162.51 kcal/mol
Frequency: 0.0000
Diversity: 580.55
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((.((.(((((((....))))))).))))))).............((((((((((((.((((((((....((((......)))).(((((((((.((((((((((..(((........)))....((((.....))))((((((....(((((((......((.(((((....)))))..))...(((((((.((((((((((((((((.(((((.((((((.........((((.....)))).........)))).)).)))))..)))).((.(((....))).))..(((((((((.(.((.....((...(((((((((..((((((.(..(((((((((((..(((....)))..)))(((.((((((.((........)).))..)))).)))......(((((..(((.(((((((((.(((((...((....))...))).))....)))))))))......((((((((((.((.........)))))).))))))(((.(..((...((((((((((.((((((((((((((((((((..((((((........))))))))).)))))).(((((((....)))))))..((((..((((.....))))))))(((......)))......))))))...((((...))))........))))).))))))))))))..).)))((((((((.(...(((............)))....(((((.....)))))....).))))))))..((((((((((((......((.((..(((((((.((..((((.(((......))).))))..(((.(((........)))..)))......(((....))).........(((((.((((...((((((.....)))).))...)))).))))))).))))))).)).))....))))))((((.(((((..(((((....((.(((((((((((..((......((.((((((.((((..((.(((((((..((...))..))))))).))((((.((((((...((...((((........))))....))....)))))).))))..(((..(((.(((..((.(((((...))))).))..))).)))..)))........)))).)))).)).)))).)))))).))))).)).......)))).)...))))).)))))))))))))..)))))....((((.........))))..)))))))))))))))..))).))))))...)).....)).).)))))))))........(((.((((..((((((...((((.......)))).)))...)))..)))))))..)))).)))))))).)))))))..)))))))))))))((((((((((((.(((((((((((.((.((((((((.......(((((((....))))))).(((((((((((.(((......))).)))))).......)))))......((((((((((((.((((((.(((((.(((((((((((((..(((((.....)))))...)))).....))))))..........))).))))))))))).(((((.(((..((....))..))).))))).(((..(((.((((((.((((((((((((((((((((((.(((...(((...))))))))))))...(((((((((..((((.((((.((((((....)))))).)))).))))...))).))))))..((.((((.((((((((((((((((((((.((((....)))).(((((..((((.(((((((.....(((((((.........((((......))))))))))))))).)))..))))))))).)))))))))))))......))))))).)))).)).(((((.(((((((..(((.((((((((.(((((.(((((.((((((((...((...))...)))........)))).).)))))...............(((((((....)))))))((((((((((....)))))))))).......((((..((((.((((.(((((((.(((.((((....)))).))))))))))...(((((((......(((((....((((((..((.(((((.........((((((.(((((.((((((((....)))))........)))))))).))))))((((.((.((((((.((......(((.((((.((((......))))............)))).))).)))))))).)).))))...(((((...)))))...(((((...(((...((((((((..((.(((((((.(((((((.(((...(((..........)))...))).)))))))...))))))).)).))))))))...))).)))))))))).)).))).))).....)))))........))))))).(((....)))...))))))))))))...))))).))).......(((.......)))..((.((((((.((...((((((.((......)).))))))....)).)))))).))))).))))).)))))))))))))))))))).)))))))).))......((.........))(((((.......)))))...((((((........)))))).........)))).))).))).....)))))))))))).(((..((((((((..(((((((.(((...)))...))))))).........((((....))))((((((((((((((((((((((((.(((...((((....))))....))).)))))).)))))))))).)))))))).(((.....))).(((.((((((((....))).......)))))))).....))))..))))..)))...........))))))))..))...))))))))))))))))))))))).....)))).)))))).)))).)))))...)))))..)))...)))......)))).)))))..........(((((..((((........))))..))))).((((((......(((((......))))))))))).........................
Thermodynamic Ensemble Prediction
,((((.((.{((((((....)))))),.))))))|{{{..{{......((((((((((((.((((((((....((((......)))).(((((((((.((((((((({..(((........)))....((((,...,))))((((({...,(((((((......((.(((((....)))))..))...(((((((.((((((((((((((((.(((((.((((((.......,.((((.....)))).,.......)))).)).)))))..)))).((.(((....))).))..(((((((((.(.((,..,,((,,,({{{{||||,.((((((.(..(((((((((((..(((....)))..)))(((.((((((.((........)).))}.}))).))).,,,,,(((((,,{({.(((((((((.{,,(({{.,,....,,....))}),....)))))))))......((((((((((.((..,......)))))),,))))){((.(..{{...((((((((((.(((((({({(((((((((({..((((((.,......))))))})).)))))).(((((((....)))))))..((((..((((.....))))))))(((....,,},}.,....}))}}}..{((({...)))),)},...}))))).))))))))))}}..},|}}((((((((.(...(((............)))..{.(((((.....))))),,..}.))))))))..{{((((((((((.......,.{{..(((((((.((,.((((.(((......))).))))...}},{{{..,,,,..,,}.}}},......(((....))).........(((((.((((...((((((.....)))).))...)))).))))),..))))))).}}..),...)))))|((((.(((((,.{((((.,..((.(((((((((((..((......((.((((((.((((..((.(((((((..((...))..))))))).))((((.((((((...((...((((.{......))))....})....)))))).))))..(((..(((.(((..((.(((({...})))).))..))).)))..)))........)))).)))).)).)))).)))))).))))).))...,...)))).}...))))).)))))))))))}}.,))))),...{{||,,,,,,,,,}}}}..))))))))))))))).,)}}.)))))}...}}.....)).}.))))))))).......,(((.((((..((({{{..,((((.,.....})}),)))...)))..)))))))..)))).)))))))).)))))))..))))))))))))){((((((((((((((((((((((({((.((((((((.......(((((((....))))))).{((({((((((,(((.....,))).)))))).......}}}}}....,.((((((((((({.((((({{(((((.(((((((((((((..(((((.....)))))...)))}}...,})))))..........))).))))))))))).(((((.(((..((....))..))).))))),({,..{((|{{{.{(.((((((((((((((((((((((.(((...(((...))))))))))))...(((((((((..((((.((((.((((({....}))))).)))).))))...)))}))))))..((.((((.((((((((((((((((((((.((((....)))).(((((..((((.({(((((....,(((((((.,.......,|||,.....,}}}))))))))))).))),,))))))))).)))))))))))))......))))))).)))).)).(((((.(((((((..((,,((((((((.(((((.{{{((,{{{{((((...{(...}}...)))}.......})}},}.}||}},..,,..,,,,,...(((((((....)))))))((((((((({....}))))))))).......((({.,((((.((((.(((((((.(((,((({....}))).))))||||||{{...,,,,,......,|,,,.,,,{{{((({{((,((({{{,..,....{{{{{{,|{{{||||{{{{{{....}}}}}......,,|||||}}},}}}}}|((((.((.{({{{{,||..,,,.||{.((((.((({......))))....,,,,,,,,||}}.})).},)))))),)).}}}},..(((((...))))).|.(((((...(((...((((((((.{({.((((((({(((({((.((({{{((,.....}}}}}}},...))).)))))))}..})))))}.)).))))))))...))).))))).}},{{(({.|,{{|...})}.),)))))...,.,}})))),||{....}))...))))))))))))...))))).)))......{(((.......))).}((.((((((.((...((((((.((......}).))))))....)).)))))).))))).))))).)))))))))))))))))))).)))))))).)).,,...{{,........,,{((((.......)))))...((((((........))))))...{{{{{.||,|,,,.,),)}}}}})))))))))))){(((.{(,(((,,(,.(((((((.(({...}))...)))))))..,,...}}},,|.}}})},(((((((((((((((((((((((((.(((.,,{{{.....,,}}..,,))).)))))).)))))))))).))))))))){({.....}))|{{{{{{{{{,{{,..,}))...,,..}}},,}||...,,},}}..},}}..},}...,,,,,,..))))))))..}..},))))))))))))))))))))))),,...}))).)))))).)))).)))))...)))))..)))...))}.....,)))).)))))......}}.}|||,,,{(((({...,,.,||,,..||},..{(((({......(((((......))))))))))}..........,},,...}}}}}},.

Transcripts

ID Sequence Length GC content
ACAGCUGUGUUUGGCUGCAGGGCCAAGAGCGCUGUCAAGAAGACCCACA… 3171 nt 0.5156
ACAGCUGUGUUUGGCUGCAGGGCCAAGAGCGCUGUCAAGAAGACCCACA… 3180 nt 0.5167
Showing 11 to 12 of 12 entries
Summary

This gene encodes a member of the serine proteinase inhibitor (serpin) superfamily. This member is the principal inhibitor of tissue plasminogen activator (tPA) and urokinase (uPA), and hence is an inhibitor of fibrinolysis. The protein also functions as a component of innate antiviral immunity. Defects in this gene are the cause of plasminogen activator inhibitor-1 deficiency (PAI-1 deficiency), and high concentrations of the gene product are associated with thrombophilia. [provided by RefSeq, Aug 2020]

Forensic Context

A study in human prostate tissue demonstrated that the SERPINE1 is upregulated in samples with a high postmortem interval (PMI) and is involved in enzyme and protease binding molecular functions [Javan et al. DOI:10.1038/s41598-025-29561-7]. In rhesus macaques, the SERPINE1 was identified as a differentially expressed gene upregulated in animals with hypertrophic cardiomyopathy [Rivas et al. DOI:10.1038/s41598-024-82770-4]. A study in rats demonstrated that the SERPINE1 mRNA expression was significantly increased in skin incision wound tissue at 1 and 3 days post-wounding, and its protein was localized to endothelial cells, fibroblasts, and leukocytes at the wound site [Kameyama et al. DOI:10.1016/J.Legalmed.2015.02.007]. In pediatric septic shock patients, plasma levels of the SERPINE1 were significantly elevated in a subclass characterized by worse clinical outcomes, innate immune upregulation, and endothelial injury [Yang et al. DOI:10.1186/s13054-023-04689-y].