Basic Information

Symbol
SERPINH1
RNA class
mRNA
Alias
Serpin Family H Member 1 HSP47 SERPINH2 CBP1 CBP2 Serine (Or Cysteine) Proteinase Inhibitor, Clade H (Heat Shock Protein 47), Member 1, (Collagen Binding Protein 1) Serpin Peptidase Inhibitor, Clade H (Heat Shock Protein 47), Member 1, (Collagen Binding Protein 1) Cell Proliferation-Inducing Gene 14 Protein Rheumatoid Arthritis-Related Antigen RA-A47 Arsenic-Transactivated Protein 3 Collagen Binding Protein 1 47 KDa Heat Shock Protein Heat Shock Protein 47 Serpin H1 Colligin AsTP3 Serine (Or Cysteine) Proteinase Inhibitor, Clade H (Heat Shock Protein 47), Member 2, (Collagen-Binding Protein 2) Serine (Or Cysteine) Proteinase Inhibitor, Clade H (Heat Shock Protein 47), Member 2 Rheumatoid Arthritis Antigen A-47 Collagen-Binding Protein Colligin-1 Colligin-2 RA-A47 PIG14 PPROM OI10 Gp46
Location (GRCh38)
Forensic tag(s)
Forensic psychiatry evaluation Other applications

MANE select

Transcript ID
NM_001235.5
Sequence length
2058.0 nt
GC content
0.5894

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-814.70 kcal/mol
Thermodynamic ensemble
Free energy: -852.25 kcal/mol
Frequency: 0.0000
Diversity: 638.96
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..........((.((((((((((....)))(((.(((..((((.(((((((((...(((((.((..((((....(((((........))))).....)))).((((((((((((((((((.((((..((((.(((((.....((((((....)))))))))))))))....((((((((((.((.(((..((.....(((((..((((((((((..(((((((..(((((.(((.(((((((((((((...((..(((((..(.((.(((((((.((((.((((((((..(((.....))))))))).....)).)))).))))))).)))(((..((((.(((.(((((((((......)).)).))))).))).))))..)))...))))))))))).)).)))))))..)).).)))))...))).))))))))..((((((((((.(..........((((.((((((...)))).))))))(((((((...(((......))).)))))))((((((...))))))........).))))))))))..((((........)))).............)))))))))))..))))))).))).))))))).((((......))))((((((........)).))))..))))...))))).....)))).).)))))))).)).))).))...)))))....))))...((((.((..(((...)))..))))))..(((((((.....)))))))..((((((....))))))..(.((((.....)))).)((((.(((....))))))))))).))))))...........)).))))).)).(((((((((((..(((.((..(.((((((((((((...(((((((..((.((.(((((((...((.((((...)))).))...(((((...)))))..(((((((........)))))))(((((..((((.((((.((((((....(((((..((((((((((((..((.(((((((((((((.((((........))))...(.((((((((((((((...(((((.....)))))..........(((.((((..((((((..........))))))..)).))))).))))))))).))))).).))))).)))))))).)).)))....))))))))).)))))......).)))))...((((.(((.((((...........)))).)))..)))).....))))))))))))).(((.((.(((...(((....(((.(((...........))).))))))))).))))))))))))...)).))..)).)))))...)))))..)))).)))).)).))).))))((((((..(((((((((.((((.(((....)))))..((((((((((((((((.((((((........((((((((...(((((((((((((((....(((((((((...)))).))..)))(((((......)).))).........)))))).((((..((((..((((....(((((..((.((((((....((((((...))))))..))))))))..)))))))))...)))).....)))).........)))))))))...))))))))......(((((((......(((((....))))).....))).))))(((((((......)))))))..............)))))).)).))))))))))))))((((....(((((((((.......(((((.((....)).)))))(.((((((((..((((......))))((((......)))).((((...((((((((((((((...)))))))).)).))))..))))........))))))))))))).))))).((((.....))))....(((((((((((((..(((....)))))))))))))))))))).)).))))))))).)))).)).........((......)).....................))))))).......
Thermodynamic Ensemble Prediction
..(({.{{{,..{(((,{.(((((,,((((((((((,.(((((({(((((((.(((.(((.((((.((((....(((((........))))).....))))..{{.((((((((((((,,,,||}(((((((((((((((..((((((....)))))).((((......)))),|.,(((({({,(((,,,|||.||||||,,,{(((((({{{..,((((((,.{((((,{{(.((((((((({{(({{{(({.,,,((,{{{{{|,|(((,(|(((,.{{((((((..(({....,),,)))))).....,{{{,(((((.((((.(((((({((((....}}},}||||)))).)))).))))).))).}}},)))),.})}.}}))}}})}))}}.)).}))))))..)).},})))),..))}},)),)))),.((((((((((,|.,,,{,,...((((.((((((...)))).)))))){((((((...(((......))).))))))|((((({...})))))|||,,,..|,))))))))))..((((........))))..}}.........}}}}}}))|{||....})}|.|||||},|{.{((({{......))))))})}}|,{,.{(((.((((...,..{.(((({{((((((,,,,,(((({((,{{{{(,,((({...,},..},}..)))),}}||||{{(,,(((,..,}|..}}}},,..(((((((.....)))))))...)))))))))}}))))))))))).,.....)))).))))||{{{,{.,||||||,,...}}|{|{{.,..,,.,,.{,.....,}}.||,....,))}}..,)))))),|.{(((((((((((...{((((((..((.((.(((((((.,.(((({((...}}||.{{,..{{{,({{{||||{,.(((((((........))))))){{{{{,.,{{(,{(((.{{{{({.{..(((((..((((((((((((..((.(((((((((((((.((((........)))).,.{.((((((((((((((...(((((.....)))))..........{(,{((((..((((((,,....},..))))))..)).))))}.))))))))).))))),,.)))))}}))))))).)).))}...,))))))))).)))))..,.,,|,||}||..{(((({(,{,{{||,}}}.|||}..})}}})))}.}}},.....}}})}}))))))).{{{{({{(({..{{{...,.||.}}})}))},,}}}..)))}))}}))},,))).,.)))))))...)}.))..)).)))))...)))))..)))).))},.))))).)))))))))).,((((.(((.(((,.....,.,))).))).))))|||,}))))))))||{((((,,,.|}}}|(((,,,|}},,,)))).))).))}.........,.((((..(((((((.{(.(((.(((..,,,.......},......))).))}))))))))))))).,....{(((((((({.((((((....((((({...})))))..))))))}|..(((((((((..{(|{{((...(((((((.....{||((|,,,....((({||.,..{{(((((.{{(({.......,))))}.{{{,.......(((((.((((((.((((.,,........,|................)))))))))),))))).........}))}}....)))))}}..,.|})}|})}})}..)))))))))))))....})))))))),}}}((((......)))).{|||..,|{{{{{{{||||||,,,}))))))),}|.}}))..)))},.))))))))).))))))))),,)))))).}))))))))))|,(((((((((((((({..(((....})}}))))))))))))))})}}.,))))),{{((({....,,,...,,,.{,......)}}}}}..}}}}.,,),,.,,............,,..

Transcripts

ID Sequence Length GC content
AAGAGUAGAAUCGUGUCGCGGCUCGAGAGCGAGAGUCACGUCCCGGCGC… 2102 nt 0.5875
AAGAGUAGAAUCGUGUCGCGGCUCGAGAGCGAGAGUCACGUCCCGGCGC… 2058 nt 0.5894
Summary

This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The encoded protein is localized to the endoplasmic reticulum and plays a role in collagen biosynthesis as a collagen-specific molecular chaperone. Autoantibodies to the encoded protein have been found in patients with rheumatoid arthritis. Expression of this gene may be a marker for cancer, and nucleotide polymorphisms in this gene may be associated with preterm birth caused by preterm premature rupture of membranes. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, May 2011]

Forensic Context

A study in human postmortem dorsolateral prefrontal cortex demonstrated lower expression of the SERPINH1 in both major depressive disorder and suicide compared to non-psychiatric controls [Pantazatos et al. DOI:10.1038/mp.2016.130]. Separately, an integrated multi-omics analysis of human menstrual blood-derived mesenchymal stem cells identified the SERPINH1 within a protein-protein interaction network related to extracellular matrix organization in the context of endometriosis [Penariol et al. DOI:10.3390/ijms231911515].