| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAGAGUAGAAUCGUGUCGCGGCUCGAGAGCGAGAGUCACGUCCCGGCGC… | 2102 nt | 0.5875 | |
| AAGAGUAGAAUCGUGUCGCGGCUCGAGAGCGAGAGUCACGUCCCGGCGC… | 2058 nt | 0.5894 |
This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The encoded protein is localized to the endoplasmic reticulum and plays a role in collagen biosynthesis as a collagen-specific molecular chaperone. Autoantibodies to the encoded protein have been found in patients with rheumatoid arthritis. Expression of this gene may be a marker for cancer, and nucleotide polymorphisms in this gene may be associated with preterm birth caused by preterm premature rupture of membranes. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, May 2011]
A study in human postmortem dorsolateral prefrontal cortex demonstrated lower expression of the SERPINH1 in both major depressive disorder and suicide compared to non-psychiatric controls [Pantazatos et al. DOI:10.1038/mp.2016.130]. Separately, an integrated multi-omics analysis of human menstrual blood-derived mesenchymal stem cells identified the SERPINH1 within a protein-protein interaction network related to extracellular matrix organization in the context of endometriosis [Penariol et al. DOI:10.3390/ijms231911515].