| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUUCUUUGCCCGCCGUUCGCCAAACGAAGUCGUGGAGGUGGCGAAACG… | 1619 nt | 0.6652 |
This gene encodes subunit 2 of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer includes subunits 1, 2 and 3 and is necessary for the in vitro conversion of 15S U2 snRNP into an active 17S particle that performs pre-mRNA splicing. Subunit 2 interacts with subunit 1 through its amino-terminus while the single zinc finger domain of subunit 2 plays a role in its binding to the 15S U2 snRNP. Subunit 2 may also function independently of its RNA splicing function as a microtubule-binding protein. [provided by RefSeq, Jul 2008]
A study in rats and humans demonstrated that the splicing factor SF3A2 exhibits increased mRNA expression in the hippocampus of male rats during withdrawal from chronic ethanol exposure, while its expression is decreased in female rats during withdrawal; no significant change was observed in the hippocampus of human subjects with alcohol use disorder [Carvalho et al. DOI:10.1038/S41380-023-02184-Y].