Basic Information

Symbol
SF3A2
RNA class
mRNA
Alias
Splicing Factor 3a Subunit 2 SF3a66 SAP62 PRPF11 Prp11 Splicing Factor 3a, Subunit 2, 66kDa Splicing Factor 3a, Subunit 2, 66kD SAP 62 Pre-MRNA Splicing Factor SF3A, Subunit 2 Spliceosome Associated Protein 62 Spliceosome-Associated Protein 62 Splicing Factor 3A Subunit 2
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_007165.5
Sequence length
1619.0 nt
GC content
0.6652

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-657.10 kcal/mol
Thermodynamic ensemble
Free energy: -682.58 kcal/mol
Frequency: 0.0000
Diversity: 272.88
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((((...((.....))....)))))..((((.((.((((..(((((((((((...(((((((((((((((.(((((.((...)).).)))).))))).)))))).......(((....))).(.(((((((((........))))).)))).)))))...))))))))).(((((((.((.((....))))((((((((..(((.(((((((((((.(.((.(((...(((...(((((((((..(((.....)))..))..))).)))).)))..(((.....))).(((....))).......((((((((......(((.(.((.(((((((.....(((((((......))))...(((.....)))..((((((..(((.((((((.(...((((.(((((((((..(((...((((((((((..............(((.((.((((.(((((.....(((((....(((.(((.((.((.((((((((..(((((((((....(((((..........))).)).....)))((((...)))).(((...(((.........))).))).(((((((..((.((((((((...((((.((((((.....(((((.(((.((..........(((........)))...(((((((((..(..((((((.((.(((((.(((.......((((...((((((...((((((.(.....).))))))))))))))))........(((((..((((((((......(((((......))))).....))))))....))...)))))))))))))..))..))))))..)..))))).)))))).))))))))..)))))).))))....)).)))))).))))))))).......((((......)))).((((((((..(((((...(((...(((((((((.........))))...)))))...)))...))))).)).)))))).......)).)))).)))))))).)).))))))))..)).))).....))).)).)))).)))))((((((...))))))......)))).....((((((......))))))...((((((......))))))..((.((((((........)))))).))..)))))).))).((((((((((((........))))))))))))................((((((((((((((((.......)))))))........)))))))))........)))))))....(((((((((((..........))).))))))))..((((((((((((.........))).))))))))).....)).)))).).))))))...)))..))))))(((((((((((((.........))))))........))))))).)))))))..))))).))))....))))))))))).))))))))).............(((............)))..((((((.........))).)))))))))))))))))))..((((((((.......)))))))))))))))..))..))))))))))....................
Thermodynamic Ensemble Prediction
..,,.((((.,,((,.,{{||,,,,,}}}}..||||,||,||||,...(((((((((...(((((((((((((((.(((({.{,...)).,.)))).))))).)))))).......(((....))).,.,((((((((........))))).)))},|))))...))))))))).(((((((.,{,{,....},||((((((((..(((.(((((((((((.(.((.(((...{{{...(((((((({..(((.....)))..,,.,))).)))).))}..(((.....))).{{,....}},.......((((((((......(((.(.{,.(((((((.....{,.((((......))))...(((.....)))..((((((..(((.((((((.{...((((.(((((((((..(((...((((({((((..,..{{{.{{{..(((.((.((((.(((((.....(((((....(((.(((.((.((.((((((((..{((((,..,|||,.{{{({{,..,....,,}.)}}}...}}||(({,..}}},.(({...{((.........))).}}}.(((((((..,(.((((((((...((((.((((((.....(((((.(((.((.,........{{,......,.,,,...(((((((((..(..((((((.((.(((((.(((..,,...((((...((((((...((((((,,.....).)))))))))))))))),,......(((((..(((...((({....{{|||}.....|||}|{{{{..,)))))..,))))})))))))))))))..))..))))))..)..)))))},))))).))))))))..)))))).))))....)).)))))),,}))))))).....,,||||....{{(((..((((((((..(((((...(((...(((((((((.........))))...)))))...)))...))))).)).))))))...}}})),.))))})))))))).)).))))))))..)),})).....))).)).)))).)))))((((((...))))))......))).,}}.,((((((......))))))...((((((......))))))..{({((((((........})})))})).,,,,,,,.,,,.((((((((((((........))))))))))))......,,,.,.....{{((((({{{{{{{{{.,,...,))))))|,.....,,))))))))).....}}})))))))....(((((((((((..........))).))))))))..((((((((((((.........))).))))))))).....)).)))).}.))))))...)))..))))))(((((((((((((.........))))))........))))))).,}})))}..))))}.))))....))))))))))).))))))))).............,{{............)))..((((((.........))),,)))))))))))))))))),.((((((((.....,.)))))))))))))))..},..}))))))})},.........,,,.,.....

Transcripts

ID Sequence Length GC content
CUUUCUUUGCCCGCCGUUCGCCAAACGAAGUCGUGGAGGUGGCGAAACG… 1619 nt 0.6652
Summary

This gene encodes subunit 2 of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer includes subunits 1, 2 and 3 and is necessary for the in vitro conversion of 15S U2 snRNP into an active 17S particle that performs pre-mRNA splicing. Subunit 2 interacts with subunit 1 through its amino-terminus while the single zinc finger domain of subunit 2 plays a role in its binding to the 15S U2 snRNP. Subunit 2 may also function independently of its RNA splicing function as a microtubule-binding protein. [provided by RefSeq, Jul 2008]

Forensic Context

A study in rats and humans demonstrated that the splicing factor SF3A2 exhibits increased mRNA expression in the hippocampus of male rats during withdrawal from chronic ethanol exposure, while its expression is decreased in female rats during withdrawal; no significant change was observed in the hippocampus of human subjects with alcohol use disorder [Carvalho et al. DOI:10.1038/S41380-023-02184-Y].