| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCUCCUGUAAAACGCUAGAGCGGCGAGUUGUUACCUGCGUCCUCUGA… | 690 nt | 0.5652 |
Enables RNA binding activity and splicing factor binding activity. Involved in mRNA splicing, via spliceosome. Located in nucleoplasm. Part of U12-type spliceosomal complex and U2-type precatalytic spliceosome. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice demonstrated that the SF3B5 was identified as an overlapping differentially expressed gene from a microarray study, located on proximal chromosome 10 and overexpressed in the methamphetamine high drinking (MAHDR) line [Hitzemann et al. DOI:10.3390/brainsci9070155]. In a separate study of human post-mortem tissues, the SF3B5 was found to be upregulated as part of the metabolism of RNA pathway in the colon of sepsis patients [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938].