| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCCUGUGUCAUCCGCCAUUUUGUGAGAAGCAAGGUGGCCUCCACGUUUC… | 3740 nt | 0.4880 |
Enables DNA binding activity; histone deacetylase binding activity; and protein homodimerization activity. Involved in several processes, including alternative mRNA splicing, via spliceosome; positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway; and regulation of transcription by RNA polymerase II. Acts upstream of or within double-strand break repair via homologous recombination. Located in chromatin; nuclear matrix; and paraspeckles. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans demonstrated that the SFPQ is upregulated in endothelial cells of the corpus cavernosum from patients with organic erectile dysfunction, where it is associated with cell death in response to oxidative stress [Zhao et al. DOI:10.1038/s41467-022-31950-9].