Basic Information

Symbol
SFPQ
RNA class
mRNA
Alias
Splicing Factor Proline And Glutamine Rich PSF PPP1R140 Polypyrimidine Tract Binding Protein Associated Protein Phosphatase 1, Regulatory Subunit 140 DNA-Binding P52/P100 Complex, 100 KDa Subunit Splicing Factor, Proline- And Glutamine-Rich Splicing Factor Proline/Glutamine-Rich 100 KDa DNA-Pairing Protein Splicing Factor Proline/Glutamine Rich (Polypyrimidine Tract-Binding Protein-Associated) Splicing Factor Proline/Glutamine Rich (Polypyrimidine Tract Binding Protein Associated) Polypyrimidine Tract-Binding Protein-Associated Splicing Factor Polypyrimidine Tract-Binding Protein-Associated-Splicing Factor Epididymis Secretory Sperm Binding Protein PTB-Associated Splicing Factor PTB-Associated-Splicing Factor HPOMp100 POMP100
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_005066.3
Sequence length
3740.0 nt
GC content
0.4880

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1256.70 kcal/mol
Thermodynamic ensemble
Free energy: -1321.51 kcal/mol
Frequency: 0.0000
Diversity: 1043.38
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((......((((((((((.....))))))))))(((((.((((...(((((((((((..((((..((((((((((.(((..(((.........)))..)))..)))))(((.(((.(((((((((((((((((((((......((.(((((((.((.((((((((.((((((....(((.....))).....))))))))))..(((((.(..........).)))))...(((((..(((..(((((.....)))))...)))...))))))))).)).))))))).))............))))))))))......))))))))))).((.(((((((((((.(((((....(((.((.((.(((((((....))....((((.((..((((((((....(((....)))..(((((.....(((((((((((((((...(((((((((((.(((.(.((....(((((.....))).))....))).)))))))).........))))))...))).))))))(..((((((((.(.((((((((.((((((((((........((((((.(((((((((((((.....(((((((......)))))))..................((.(((((((.....))))))).))))))).))))))))..((((.((.((((((.....)))))).))))))(((((((((...((.(((.....(((((((........)))))))(((.(((.((((........))))))).))).((((..((((((.......)))))))))).)))))...))))))))).(((((.(((((((......(((((((((......((((((((....)).))))))(((((((.(..((((((((...))))...))))..).))))....)))........((((((.(((...))).))))))...((.(((.(((((.......))))).))).))((((.(((((.(((......)))))).)).)))).(((((((.(((.((......((....)))).)))))))))).........(((((((...(((((((((.......))))))).))((((((((.......))))))))((((((.((.(...(((((....).))).)....).)).)))))))))))))....))))))))).(((((((...(((..(((((((.((((((((((((((.....)))))))...(((((((..((((..((((((......)))))))))).....((((((..((...))..))))))........((((((((.((..(((((((..((.....)).)))..)))).)).))))))))..))))))).(((((((.(((.((.....(((((.((..((((((((((((((((((.(.((......)).).))).))))(((((......((((..((((.....((...((((((((((.(((.(((......)))))).))))(((......)))......(((((....)))))(((((..((....((((((..................))))))...)).))))).............))))))...))....)))).)))).....))))).(((((............)))))..(((((((((.(..(((((..((......))...)).)))..).))))..)))))..)))))))).......((((..............)))).....)))..)).)))))....)))))))))))).....(((((....))))).))))))).))))))).........)))....)))))))...(((((((((.....)))).((((((.((((..........(((....)))(((.((((.(((((..((((((((((.....))))).)))))....(((((......(((((((...)))))))((((..((((...))))..))))...)))))))))).)).)).)))....)))).)))))).......)))))..((((.....))))...)))).))).)))))))))))))))))))).).))))).....))).).))))))))..)...(((((((.((((..((((((.(......(((....(((((((((...............((((.((.(((((((((........(((......))).......))))))))).))))))......(((((((......))))))).(((((....(((((((((((((..(((....))))))))))))))))))))).)))))))))..)))..........((((((((...((((.(((((((.....))))))).................))))....))))))))..).))))))((((((((((((..........))))).))))))).(((((((.(((...(((((.(((((((....((((((.......(((..((((.......))))..)))........(((....((((......))))....)))(((.(((((((((..(((((((....(((.(((((((((..(((((((....)))))))..))).......)))))).)))......)))))))................((((.......))))....(((((((((((((((((((((....((((((((.((((.....(((((....))))).(.(((((...))))).)))))))))))))..))))))).....)))))...))))))))).....))))))))).)))..........((((((((((((..(((((((.((((.....))))......))))).))..)).)))))))))))).))))...))))))).)))))))))))))))..........)))).)))))))......(((........)))((((((........))))))((((((((((((((((((.......))))))...(((((((.....))))))).(((((((.........((((........))))..........))))))).....)))))))))))).)))))))))))))))))))...)).))))..((((((....))))))))))).))))))).......(((((..((.(((....((((...((.....))))))..))))).))))).....................)))))..)))))))).)))))(((......)))..))))))))))).)))).))))))..))))))))).))))).(((((..(((((((.((.......))))))))))))))(((((.....))).))(((((...)))))...........((((..((((((((..(((((...(((((((..(((....)))...)))))))))))).(((((..(((((((.(((..((((.....))))..)))..........(((((((((((......)))))))))))((((((((..(((......)))..)))))))).......((.((((..(((((((....))).))))..)))).)).))))))).......)))))..((.((....)).)).))))))...))..)))).....))).....))))..........
Thermodynamic Ensemble Prediction
{{,,{(((({(((((((((((((.....)))))))))){(({(((((((((..(((((((((((.((((((((((((,,(,((({,((,.........|||.,|||,,|}}||,,((({{,(((((((((((((((((((((......((.(((((((.((.((((((((.((((((....(((.....))).....)))))))))),,(((((.(..........).))))),,,(((((..(((..(((((.....)))))...)))...))))))))).)).))))))).))....,..{,....)),.,,.,.((.((.((....)).)).)),||}||,,}}||....))}))})),)).}}}...((.((....)).)).||.|||||||},,||||||}.|||,||{|||,.(({,{((({({(({.{(((,,{({{..,|{{|||,||||.|{{,{|{,....,,,{{{{{{.|||{||{{{{||{{|||,,,,.........{||||||{{{||,.||||||(((({,(({{((....,}..,|{((((((((..{,....(((((((..(((((((((((((.....(((((((......)))))))..................((.(((((((.....)))))))}),))))).))))))))((((((.((.((((((.....)))))).)))))))),.{,{,...{((((......))))))).))))))).)}))))))))))}})))))))..,,..|||((((((({.(((,..{{((((,,.....))))))((({..,||}|,})))))))))))}....,..||.,........}..,........)))))))))),..))))))}.,)),)))}),}))..)))}..}}})))}}}}}}}})))))),.....((((((((((((((((.(((...))).)))))}...((.(((.(((((.......))))).))).}){,,({,.(((.(((....},}),))).,}.||||,{{{((((.,(({({.....,,{,,,.,{{(((((.(((((({(({.,...(((((((,,,(((((((({.......))))))}.,,((((((((.......))))))))((((((.((.(...,((({....}.))).,....}.)).))))))))))))).....{(({((({,{((((((.{..(({(((((((((.,,,,.,,((({....{((((((.((..(((((((...((((..,,....)})).))))))).)).))))))))}}.,},.))))))))).)))},))))))|{{,,,,|.,,..,(((,...,||}}}})))||||,,||(({{|..||}}}}}.||..|||||}||||},{{((((((,......}}))).}))||..|,|}},.)))})..,}.....,.))))))))))..))}}))))....,{,({{{{,,,....,{{,{(((..(((((.(((.(((......)))))).))))|,,..}}}}))}},||||{{{,,......}})}}))))}.,..}}}}}}}}}}}....||......}}||}..,,...||.|||,.....}}),},....,}}}...,))))))))))...||||...||{{{|{((({.........,,.))))}..}}|}}||||,,..|,|||,,||.,}}}})}}}.}}......}.})),}}))}}}..|||........,,,.((((....,.....,...)))).}))))))))))))))))).)))))....,..)))},..(((((....))))),))))),).,|},.,..},....||||.{{.......||...,||..((((.....)))).((((((.((((..........{,,....|||(,{,{(((.(((((..((((((((((.....))))),}))))....(((((......(((((((...)))))))((((..((((...))))..))))...)))))))))).)).}).,))}}..)))).))))))...}},.}))))}}((((.((((((.(((((((..((((((.{.((({(((((((((,..(,((((((((......)))))))),...}{(((((((((..(((((.(((((((..((((((((((,(((((((({............,,,((((.{{.(((((((((........{{{......|}}.......))))))))),}}}}}},,,,,,(((((((......))))))}.,,,,....{(((((((((((((..(((....)))))))))))))))))|))}.})))))))),{({{,,{..,,{,.(((((({{..,((((.(((((((.....))))))).,,,,............}}}}....)))))))).,|,,.,,..{{((((((((((..........))))).))}}}}}.,,.|||||{|,,|{{{((({{(({{{{{(((..{((.........}}}..}))}}.......,{({{{{||,..,{{(((..,,((((,,,.,,|}},....|}},,|.||{{,,,||,.|||||||}}}.(((.{((((((((,.(((((((....)))))))..|||{{{{{{,,}}|||{||,......,))))))..,......{{{{,{{((((,{{{,,..,,,....((((((((((((((((((((,..,.(((((((,{((((.....(((((....))))).,.{{{{,...,}}}}.,)))))))))))).,,)))))).....)))))...)))))))))...,,}}}}}}}}}.}}},}},}}}}.,,{{|||||||||..{.(((((,,,.,.....},}},,},,.})))),{|({{{{.|{{,,,||{({{{,,,..,,||,|}},})),}))))}}...,.)))})))))},.,,|}{{||||||,..||||,,,{,..,,,(({{((.,,,,,,,}|||||.,|,,....,,.{(((((,,,,...}}}}}}...(((((((,...,))))))),}}))))),}}}}},}.|||}}}}}},}.)})},}}}}}}}},||{|,...,,..}}))))))}),.,||{(({(((((,,.{|,||||{(((({{,..((((({....}))))).|,.||||||||},,|,{,{|}|,|||{(.({{,..|}},..}}|}}||..,}}))}...,|)}}|||||,..,...............{{{{{|||,}||||{||..,}))),.....)))))})}{{{{|,..,)))}){({{{.......|}}|,,}}}}},,.{((((..{((((((.((.......)))))))))))))}(((((.....))).))(((((...)))))..}}}}}}}})}))))}}|}}|||{,,...}})))))),.},....,.}))))))))){{{,....}}}.))))))).))))).)))))))))}....)))))))))...........(((((((((((......)))))))))))((((((((..(((......)))..)))))))).......((.{(((..(((((((....))).))))..)))}.)}{((((((......{{......)).,.,,,.))))))}.,,,.......,)))}.)))))).)).})))))))))).})}}.

Transcripts

ID Sequence Length GC content
GCCUGUGUCAUCCGCCAUUUUGUGAGAAGCAAGGUGGCCUCCACGUUUC… 3740 nt 0.4880
Summary

Enables DNA binding activity; histone deacetylase binding activity; and protein homodimerization activity. Involved in several processes, including alternative mRNA splicing, via spliceosome; positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway; and regulation of transcription by RNA polymerase II. Acts upstream of or within double-strand break repair via homologous recombination. Located in chromatin; nuclear matrix; and paraspeckles. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in humans demonstrated that the SFPQ is upregulated in endothelial cells of the corpus cavernosum from patients with organic erectile dysfunction, where it is associated with cell death in response to oxidative stress [Zhao et al. DOI:10.1038/s41467-022-31950-9].