Basic Information

Symbol
SFRP1
RNA class
mRNA
Alias
Secreted Frizzled Related Protein 1 SARP2 FRP-1 FRP Secreted Apoptosis-Related Protein 2 Secreted Frizzled-Related Protein 1 SARP-2 SFRP-1 FRP1 Frizzled-Related Protein FrzA
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_003012.5
Sequence length
4464.0 nt
GC content
0.4991

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1512.60 kcal/mol
Thermodynamic ensemble
Free energy: -1592.93 kcal/mol
Frequency: 0.0000
Diversity: 1017.27
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((.((.((((((....((((((((((..((((.(.((((.(((.(((((((((.((((((.(((.(((((((((((.((.((((((((((((((..((.((((.((......))..)))).)).((((.((((.(((((.((((.((...((.((((.....)))).)))).)))).)))))))))...))))....))))))...))))))))..)).)))))))))........))..))))))))).).)))))))).)))))))).)))).....))).)).)))))..))))))(((((((((((..(((((.(((((((((((((((((((((((.(((((...))))))))..(((((((((.(((...((..((((((((.((((((.((((((.(((...((((....)))).)))((((((.((......((((((......))))))((((.......))))(((....))).((((.(((..(((((....)))))..)))))))....(((((..((.........))..))))).)).)))))))).)))).))))))))))))))..))..))))))))))))((((((((...((....((.....))....)).)))))))))))))))))).)))........)))))))..))))).((((((.........))).))))))))))))))..))..))))))...((((((((((.(((((((((((((((.((((......)))).)))).)))...)))))))..((((((....))))))..).)).))).)))))..(((((((((.((.((...(((((...(((....))).((((....(((((.....).))))....))))......)))))((....))..((((((.((((..........)))).)).))))...........((((...........(((.(((((.....))))).)))..........(((((.......)))))((.((.....)).))..........(((((((((((.((((.....(((((((((.(((((..((.....)).)))))...)))))).)))((((((.(((...((((....(((.....)))....((((((..(((((((.(((..((((...........((.((((((....)))))).))..............))))..)))(((((((((...((((.((...............)).)))))))))))))..(((((((..((.((((.((((((((((......((((..((((((((((((((((.(((......((((((........)))))).....))).))))).))))...)))))))..)))))))))))))).)))).))..))....)))))..(((....)))....))))))).....)))))))))).....))).))))))..........(((((...)))))((((......)))).)))).(((((((......))))))).))))).))).)))))))............)))).))))))))).((((((..(((((((((((((......))))))....)))))))(((((((........)))))))(((..(((..((((....)))).)))..)))(((((.((((.(((((((((.((..((.((((((((..(((((.(((.....))).)))))((...((.((((((((.....(((...))).......)).))))))..))...))....(((..(((.(((((...)))))))).)))..((((.(((((((((((........))))).)))((((((.........))))))..((((..(((.......)))..))))(((((((........(((((....))))).)))))))...))).))))...((((((.((..(((((.....)))))..)).)))))).....)))))))).))..)).))))))))).))))..)))))...(((((((((((((..(((......(((((..(((((((((((..((((((((((.......(((((((....((((...)))).((((..(((((.(((((((..(((.(((((((...((((....))))...))))))))))))))))).))).......))..)))).......(((......(((((((((((....((((((((((((.(..((((..(((((((..(((((((((.(((..(((((((....(((((((((.....)))))))))(((((..(((....)))..))))))))))))....(((((((((((((.((((.(((((......)))......((((((...((((.............))))...))).)))((((((((((......((((((.....))))))((((((((..(((((((..(((....((((((((......(((((((.....((((((((...(((((((.........((((((.........))))))(((((((((...(((((((((...)))))))))((.(((((((((........)))).))))))).(((((....(((((........)))))...))))).(((((((...(((...)))..)))))))..............))))))).))((((((((.......))))))))(((..((((.....(((((((((..(((..((..((((((.(((((((((((...(((.((.(((((((.(((((........)))))(((((((.((..(((...........(((..(((((((.(.((((.......)))).)))))))))))))).)).)))))))((((((((((..((.(((............))).))..(((((........))))).......(((((..((.(((((((((...........))).))))).).))..))))).))))))))))...........((.((((((......)))))).))...))))))).)).)))..))))).)))))).))......))))..))..))).))))))))).....)))))))..(((((...)))))((((((((...(((...)))....))))).))).....))))))).))))..))))....)))))))))))))))..))))))))))((((.((((.((((((((((((((((...((.(((...(((...(((((.((((((((((.((......)).))).)))))))....)))))..)))..))).))....))))))......)))))))).))))))..))))(((((((((..((((....))))..)))(((((....)))))....))))))...........)))))))).....((.(((((((((((....(((......(((((.(((....))).)))))..(((.(((.....))).))).)))...))))))))))).))((((..((((...............))))..)))).))))))))))....)).)))).))))))))))))).))).)))))))))....)))).....)))..)))).)))))))..))))))...((((........))))...((((((((((.((((((...(((((((((......(((....(((.(((((...((((((....))))))...))))).)))....)))..)))))))))...))))))..((((........))))............(((((((....))))))).(((((((((.(((((.(........((((....))))((((((.((((((.(((.((((((((((((((..(((..(((.....)))..)))..)))))....)))...))))))..)))))))))..))))))..........).))))))))))))))..((((.....(((((((((((.((((((((((((..(((....(((((.........)))))...)))...))))))).).))))..)))))))))))...))))....(((((((((..(((...(((((....(......)..))))).........((((.((((.........)))).))))...)))..)))))))))..))))))))))((((.....))))......)))))))))))....)))....))))))).......))))))))))....)))))))))))((((((....)))))).(((((((........)))))))..(((.......))))))))......)))....)))))))))))))............))))))........................
Thermodynamic Ensemble Prediction
((((((.((.((((((....((((((((((.{((((.(.((((((((.(((((((((.((((((.(((.({(((((((((.((.((((((((,,{{(({(,({(((,.(({,,,,.((((({(({((,,,,{.{{{{.((((|.,|||}{{..{((.((((.....)))).))),.)),.))))}))))).)},))))..}))))))}..))))))))..)).)))))))))........},..))))))))).).)))))))).)))))))}.)))).,...))).)).)))))..))))))(((((((((((..(((((.(((((((((((((((((((((((.(((((...))))))))..(((((((((.(((...((..(((((((,{((((((.(((((({((((,((,({{{|.,||{.||,{,,|||,|{,.....((((((......)))))){{{{,......})))|||....||},((((.(((..(((({....}))))..)))))))....(((((..(,........,}}..))))}.},,))))).}).)))).))))))))))))))..))..))))))))))))((((((((...((....,,.....,)....)).)))))))))))))))))).})).,,,....)))))))..))))).((((((.........))).))))))))))))))..))..))))))..,((((((((((.,((((((((((((((.((((......)))).)))).)))...)))))))..((((((....))))))..|.)}.))),,)))).,(((((((((.((.((...(((((...(((....))).((((..{,(((((.....}.)))),}..))))......))))),.,,..|...((((((.((((.{,.....}.)))).)))})))...........,{{{...........(((.(((((.....))))).)))..........(((((.......)))))((.((.....)).)).......,..(((((((((((.((((.....(((((((((.(((((..((.....)).)))))...)))))).)))((((((.(((,..((((....(((.....)))....((((((..(((((((.(((..((((..,,.......((.((((((....)))))).)).......},.....))))..)))(((((((((...((((.((....,,.....,,..)).)))))))))))))..((((({{.,((,((((.((((({(((({{{...((((..((((((((((((((((.(((......((((((........)))))).....))).))))).))))...)))))))..))))))))}))))),)))),))..}},,..)))))..(((....)))....))))))).....)))))))))).....))).))))))..........(((((...)))))((((......)))).)))).(((((((......))))))).))))),,)).))),,)}............)))).))))))))).{(((((,.(((((((((((((......))))))....)))))))(((((((........)))))))(((..(((..((((....)))).)))..))){((((.((((.{((((((((.((..((.(((((((({{(((((,{{{....,||}.)))}}{{...((.((((((({.{{..(({...}}),......)).))))))..}),.,||...,|{,..,||||||,,,,,}}}}||||,|||{{((,..(((((,{,((((..,|||||||||,|||(((((({,.....,.|||||}..{{({..{{{...,...)))..||||{((((((........(((((....))))).)))))}},.}}}},,,...,}}||,|}}))}}|||||}}}}.),)))}))))))))))}....}))))))).))..)).))))))))}.))))..)))},...(((((((((((((,.,({......{((({.,(((((((((((..((((((((((.......(((((((..,.((({...}))}.,{(({((({..,({{{{,,..,,(,{(((((({({((({.{{{|,,|{{{|||||||,,,,,,,,,,......,}}}}))..))}........{{..((((((((((((,((({{..(((((({(((((,(,,({{{..{{{{|||,,{((((((((.(((..((((((({.,,(((((((((,....)))))))))|((((..(((....)))..))))))))))))....(((((((((((((.((((.((,,{{,.,,,|,||||,,.((((((...((((.............))))...))).)))(((((({{{{,{{{,{((({{,...,.))))))||(((({(.,(((((((..{{{....((((((((......(((((((,{...({{{((((...(((((((..........,,{(({...{{{,,,,,}}}}}|||,,,|,}.(((((((((...)))))))))((.(((((((((........)))).))))))).(((((....{((((......}.))))}...}}}}}.,,((({(,{{((,{,{|||{,|||||}|...,.,...,,,|,}}|||,,.,.((((((((,....}.)))))))),|||,|||,.....{((((((((..{{{..((,.((({((,{(((({(((({...(((.((.(((((((.(((((........))))|(((((((.({..{((........,,,{{{..(((((((.(.((((,.....,)))),})))))))}}}}}).)).)))))))|(((((((((..({,({,.,{{{,,,,.|,,|,,||..(((((........))))),,|..,{{,,..}}},}||||||||{.....,...,.}}}|,}}}|,|.}},,))))},)}))))))),..,,,......{|,|((({{,.....)))))}.},.,.})))))).)),)))..))))).)))))),},,....}))))..))..}},.})))))))),},},)},))).,,||||.....,},{((((((((...(({...}))....))))).))))....))))))).)))}..)))}....)))))))))))))))..}}}))))))}{{((.((({,{(((((((((,(((((...,,,(({.,.,((,..((((({(((((({(((.((......)).))).))))))}....)))))..}}}..)}}.}}..,,),},,}.,},,,))))))))).}}))).|)|))||||||({{..{{||...,)))),,)))|||||...,))|}),,..,))))}.........,,)}}}}})|,,...((.(((((((((((.,..{{{..,...(((((.(((....))).)))))..,{,.{{{.....,,).})).)))...))))))))))).)),{{{..{{((.........,,....})))..}}}}.)))))))))).,,.)).)))).))))))))))))).))).)}}}))))}....}))}..,..))}..}}},.|)))))}..|)))))...{{{|,,..,,,,)))|(({.,,,,,||||,((((((.{.(((((((({....,|,{{,...(((.(((((...((((((....))))))...))))).))).,,},}}..))))))))),..)))))),}},..}}}}}.}})))))))}}}..}}..(((((((....))))))).(((((((((.(((((.,.......,{{{{....}},,{(((((.((((((.(((.(((((({((((((({.(((..(((.....)))..)))}}))})}....,,,,}})))))},.)))))))))..)))))}{{|...}}}.}.))))))))))))))..,,,,.....(((((((((((.(((({(((((((..(((.,..(((((.........)))))..,)))...))))))).}.))))..)))))))))))...}|||.,,.(((((((((..{{(...(((((.,,.{......}..))))).,,..,,.,((((.{((((.,,,,.,.},)),))}),,,))}..)))))))))..))))},,,)))))))))}}).)))))}}.}}}}}))))),.,,}}}}}...})))))).,.....))))))))))....)))))))))))|((((,....}))))).,{{{(({.,.{{,.,|||,,|||.,,.,,...,,}}.)))}}......,,,....)))))))))))))..,........,)))))),,......,,.,,...........

Transcripts

ID Sequence Length GC content
GCGCACUCCAGCCCUGCAGCCUCCGGAGUCAGUGCCGCGCGCCCGCCGC… 4464 nt 0.4991
Summary

This gene encodes a member of the SFRP family that contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins. Members of this family act as soluble modulators of Wnt signaling; epigenetic silencing of SFRP genes leads to deregulated activation of the Wnt-pathway which is associated with cancer. This gene may also be involved in determining the polarity of photoreceptor cells in the retina. [provided by RefSeq, Sep 2009]

Forensic Context

A study in humans demonstrated that plasma levels of secretory frizzled-related protein 1 (SFRP1) were significantly higher in patients with acute myocardial infarction (AMI) compared to healthy controls and showed high diagnostic efficiency with an AUC of 0.9603 [Liu et al. DOI:10.3892/mmr.2023.13010]. The biomarker was positively correlated with plasma cardiac troponin I and serum low-density lipoprotein levels, supporting its role in diagnosing and assessing AMI severity.