Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCGCACUCCAGCCCUGCAGCCUCCGGAGUCAGUGCCGCGCGCCCGCCGC… | 4464 nt | 0.4991 |
Summary
This gene encodes a member of the SFRP family that contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins. Members of this family act as soluble modulators of Wnt signaling; epigenetic silencing of SFRP genes leads to deregulated activation of the Wnt-pathway which is associated with cancer. This gene may also be involved in determining the polarity of photoreceptor cells in the retina. [provided by RefSeq, Sep 2009]
Forensic Context
A study in humans demonstrated that plasma levels of secretory frizzled-related protein 1 (SFRP1) were significantly higher in patients with acute myocardial infarction (AMI) compared to healthy controls and showed high diagnostic efficiency with an AUC of 0.9603 [Liu et al. DOI:10.3892/mmr.2023.13010]. The biomarker was positively correlated with plasma cardiac troponin I and serum low-density lipoprotein levels, supporting its role in diagnosing and assessing AMI severity.