| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCGGGGCGCCCGCAGCGCAGGCUGCCACCCACCUGGGCGACCUCCGC… | 1883 nt | 0.6320 |
Secreted frizzled-related protein 5 (SFRP5) is a member of the SFRP family that contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins. SFRPs act as soluble modulators of Wnt signaling. SFRP5 and SFRP1 may be involved in determining the polarity of photoreceptor cells in the retina. SFRP5 is highly expressed in the retinal pigment epithelium, and moderately expressed in the pancreas. [provided by RefSeq, Jul 2008]
A study in Sprague-Dawley rats demonstrated that the mRNA encoding the SFRP5 exhibited a specific temporal expression pattern in injured skeletal muscle, decreasing initially and then gradually increasing toward basal levels, with its lowest expression at 20 hours post-contusion [Zhu et al. DOI:10.1016/j.jflm.2016.07.013].