| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUAGAAACAGGCCUGUUAAGGAGAGGCCACCGGGACUUCAGUGUCUCCU… | 446 nt | 0.5561 |
Predicted to be located in Golgi apparatus; extracellular region; and transport vesicle. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans identified the SFTA2 as a putative mRNA biomarker for vaginal secretions, where it was expressed at higher levels in vaginal secretions compared to saliva with an average 29-fold difference, though it showed cross-reactivity with saliva in 5 out of 15 samples tested [Hanson et al. DOI:10.1016/j.scijus.2012.03.007]. Subsequent research established a coding single nucleotide polymorphism (cSNP) typing system for vaginal secretions, incorporating the SFTA2 gene, which contains cSNPs rs2286656 and rs4713402, and demonstrated that this system could identify the donor of vaginal secretions in mixture stains with high sensitivity and specificity [Zhang et al. DOI:10.1016/j.fsigen.2022.102703].