Basic Information

Symbol
AVPR2
RNA class
mRNA
Alias
Arginine Vasopressin Receptor 2 V2R DIR3 DIR Renal-Type Arginine Vasopressin Receptor Antidiuretic Hormone Receptor Vasopressin V2 Receptor AVPR V2 ADHR Nephrogenic Diabetes Insipidus NDI1 DI1 NDI
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_000054.7
Sequence length
1825.0 nt
GC content
0.6455

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-841.10 kcal/mol
Thermodynamic ensemble
Free energy: -869.76 kcal/mol
Frequency: 0.0000
Diversity: 470.01
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((..((((.(.(((((((((((.........((((.(((((((((...(((.(((((((((..((.(.(((((((((((((((((((((((.((((((((((((((....(((((((........((((.(((((....))).)).))))..........(((((((.((((((.....))))))...(((...(((..(((((.(...).)))))...)))..)))(((((((((((((........((((..(((........)))...))))............((((.(((((((((........)))))))...)).))))....(((((((((..((((((((((....)))).....((.((((((((....)).))))))))(((((.((((((((.....))))))))....))))).))))))(((((.((((((((((((((((((((.((((((((((((((((.((((.....(((.((...(((((((........)))))))...)).)))((((..((((((.(((..(((((...((((((...))))))......((((((((((.....(((((..((((.(((.((..........((((((((((((((....))))).......((((........))))(((.(((....))).)))))))))))))).))))))).)))))....))))))))))))))).))))))))).))))))))))))))))).((((......))))....((((...(((((.(((..((((((((...............)))))))).))))))))..))))))))))).)))))).....))))..))))))))))))))).......))))).))))..(((((((...(.(((((((...((((((......(((((...))))).......))))))(((((......)))))))))))).))))))))))).)))))))))).((((...((((..(((.....)))..))))))))..)))))))))))))).)))).)))))))).........(((((((((........)).)))))))..)).))).)))))))........)))))).))))))).)))..)))))....((((((....))))))))))))).......)))))...((((((((((((.(((.......)))))........(((((...........)))))))))))))))....)))).))))...)).))))))))).)))))((((.....)))).))))))))((((((((....(.(((...((.(((..(((((((((..(((.....))).(((......)))((((((.(((((((.((((((((....))))...)))).))))))).))..)))))))))))))..)))..)).))).)...))))))))(((((((((.(((....((.(((((((((.((((.(((......((((((.........))))))..))).))))((((((((((((((...(((...(((((....))))))))....))).)))))))))))(((((.((((....)))).))))).......)))))))))))(((((..(((((((.((..(((.((((((.((....)).)))(((((((((((.((((((..((.(((.....((.....)).....))).))..))))))...)))))).))))).)))..)))..))))))))).)))))..(((((....))))).))).))))))))).
Thermodynamic Ensemble Prediction
..((((((((..((({{(.(((((((((((.....,...((((.(((((({{{...{{,.{{(((((((..{{(({(((((((((((((((((((((((.((((((((((((((....(((((((........((((.(((((....))).)).))))..........(((((((.((((((.....))))))...,{{...(((..(((((.(...}.)))))...)))..})}(((((((((((((.,......{(((,.(((....,,,.|||...||}|,......,....((((,(((((((((........)))))))...)).))))....(((((((((.,{(((({((((....)))).....({.((((((((....)).))))))))(((((.((((((((.....))))))))....))))).}))}}}(((((.((((((((((((((((((((.(((((((((((((({{{((((.....{{(.(,...{((((((.....,..))))))}...)),))}{((,,.(((((,{(((..(((((.,.((((((...)))))).,....(((((((((({{...(((((..((((.(((,((..........((((((((((((((....,)))}.....,.||||.,...,,,)}}){{{.{((....}}}.)}})))))))))}).))))))).)))))...}))))))))))))))).))))))))).))))))))))))))))).((((......))}),...((((...(((((.(((..((((((((.,.,..,,....}}})))))))).))))))))..))))))))))).)))))).....))))..)))))))))))))))...,,}.}}})).}}}),{(({((((,..{.(((((((...{{{{({,...{,{{{({...})))),......}))))){|{{,...,,.))}})))))))),)))))))))}).)))))))))).{{{({{.((((..(((.....)))..))))})))..)))))))))))))).)))).)))))))).........((((((({{........)),}))))))..)).))).)))))))........)))))).))))))},))),.)))))),..((((((....)))))),||}|||{{.....))))}.,,{{(((((((({,{{{{.......))))}.{{,....,|||,.....,,....,,}}))))))))))),.}})))}.))))...))}})))))))).)))))((((.....)))).))))))))((((((((......,{,...(({{(,,,{,((((((((({{{{,..,||}.,.|},..,,).)|||}||}|,|||||}|{{||((({,,{||||,{{|||..||}||||,}||.,,.,))))))))),}),)},))},))})}},))))))))(((((((((.((({...(,{(((((((((.((((.(((......((((((.........))))))}.))).)))).)|{(((((((,,({{{(((...((((,.{{.||,,,((((((,,.....}})))))),,,.}|.||,,}}}}..,)))))))}}}.)))))))))))))),{{||,,(((((((.((.,(({.{({(((.((....)).)))(((((((((((.((((((..((.(((,....((.....))....,})).))..))))))...))))))}})))).}}}..}}),,))))))))).,}}||,,{,{{{....}}})),)}}.))))))))).

Transcripts

ID Sequence Length GC content
AGAGGCUGGGCUGGGCCAGGGCAGGGCAGCCGAUGGAGAGCAGAUCUGA… 1825 nt 0.6455
AGAUCUGAGCACCCAGCCACCUUCACGCCACCGCCCAGCUGCCCAGGAG… 1890 nt 0.6444
Summary

This gene encodes the vasopressin receptor, type 2, also known as the V2 receptor, which belongs to the seven-transmembrane-domain G protein-coupled receptor (GPCR) superfamily, and couples to Gs thus stimulating adenylate cyclase. The subfamily that includes the V2 receptor, the V1a and V1b vasopressin receptors, the oxytocin receptor, and isotocin and mesotocin receptors in non-mammals, is well conserved, though several members signal via other G proteins. All bind similar cyclic nonapeptide hormones. The V2 receptor is expressed in the kidney tubule, predominantly in the distal convoluted tubule and collecting ducts, where its primary property is to respond to the pituitary hormone arginine vasopressin (AVP) by stimulating mechanisms that concentrate the urine and maintain water homeostasis in the organism. When the function of this gene is lost, the disease Nephrogenic Diabetes Insipidus (NDI) results. The V2 receptor is also expressed outside the kidney although its tissue localization is uncertain. When these 'extrarenal receptors' are stimulated by infusion of a V2 selective agonist (dDAVP), a variety of clotting factors are released into the bloodstream. The physiologic importance of this property is not known - its absence does not appear to be detrimental in NDI patients. The gene expression has also been described in fetal lung tissue and lung cancer associated with alternative splicing. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human postmortem renal tissue demonstrated that the immunohistochemical expression of the AVPR2 in distal ducts, connecting tubules, and collecting ducts showed no statistically significant differences among cases of saltwater drowning, freshwater drowning, and control deaths by gunshot to the head [Barranco et al. DOI:10.1007/S00414-020-02274-4].