| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGCUGCAGAGGUGCCAUGGCUGAGUCACACCUGCUGCAGUGGCUGCUG… | 3550 nt | 0.5330 | |
| AGGCUGCAGAGGUGCCAUGGCUGAGUCACACCUGCUGCAGUGGCUGCUG… | 2567 nt | 0.5333 | |
| UGUAAAUGCUCUUCUGACUAAUGCAAACCAUGUGUCCAUAGAACCAGAA… | 2850 nt | 0.5386 |
This gene encodes the pulmonary-associated surfactant protein B (SPB), an amphipathic surfactant protein essential for lung function and homeostasis after birth. Pulmonary surfactant is a surface-active lipoprotein complex composed of 90% lipids and 10% proteins which include plasma proteins and apolipoproteins SPA, SPB, SPC and SPD. The surfactant is secreted by the alveolar cells of the lung and maintains the stability of pulmonary tissue by reducing the surface tension of fluids that coat the lung. The SPB enhances the rate of spreading and increases the stability of surfactant monolayers in vitro. Multiple mutations in this gene have been identified, which cause pulmonary surfactant metabolism dysfunction type 1, also called pulmonary alveolar proteinosis due to surfactant protein B deficiency, and are associated with fatal respiratory distress in the neonatal period. Alternatively spliced transcript variants encoding the same protein have been identified.[provided by RefSeq, Feb 2010]
A study in humans demonstrated that the SFTPB mRNA marker was successfully developed and validated for the specific identification of lung tissue within a 17-plex endpoint RT-PCR assay, showing high specificity and sensitivity in analyses of 85 organ tissue specimens and a blind test set [Lindenbergh et al. DOI:10.1007/s00414-013-0895-7]. Extended specificity testing confirmed the assay's human specificity against animal organ RNAs, though the primer concentration for the SFTPB was reduced in an updated multiplex, and cross-reactivity was observed with thyroid tissue [van den Berge et al. DOI:10.1002/elps.201700241].