| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUUUGCUUGGAGCUCCUGGGGCCUAACAAAAAGAAACCUGCCAUGCUG… | 1283 nt | 0.5838 |
The protein encoded by this gene is part of the innate immune response, protecting the lungs against inhaled microorganisms and chemicals. The encoded protein may also be involved in surfactant metabolism. [provided by RefSeq, Jul 2015]
A study in humans demonstrated that the lung marker SFTPD exhibited high human specificity in organ tissue identification assays, with only sporadic false positive signals observed in some animal organ RNAs [van den Berge & Sijen DOI:10.1002/elps.201700241]. The review of forensic transcriptomics notes that SFTPD is an mRNA marker for lung identification, as mentioned in the context of tissue identification studies [Lei et al. DOI:10.1093/gpbjnl/qzag007]. A study in human forensic autopsy cases demonstrated that the SFTPD mRNA expression was significantly lower in lung specimens from drowning, mechanical asphyxiation, fire fatality, and acute cardiac deaths compared to those from fatal hypothermia and injury [Miyazato et al. DOI:10.1007/S00414-012-0698-2].