Basic Information

Symbol
SFTPD
RNA class
mRNA
Alias
Surfactant Protein D COLEC7 SP-D SFTP4 Pulmonary Surfactant-Associated Protein D Lung Surfactant Protein D Collectin-7 PSP-D Surfactant, Pulmonary-Associated Protein D Surfactant-Associated Protein, Pulmonary 4 Pulmonary Surfactant Apoprotein PSPD
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Cause of death analysis

MANE select

Transcript ID
NM_003019.5
Sequence length
1283.0 nt
GC content
0.5838

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-526.8 kcal/mol
Thermodynamic ensemble
Free energy: -547.2 kcal/mol
Frequency: 0.0000
Diversity: 436.66
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((((((((((.((((((..............((((.(((.((((((...(((((((...((.((((((.((.((..((..((((((...(((....)))..........((((((((((.((((((((.((((.(......).)))).))).)))...)).)))).))))))...))))))..))..)))))))))).)))))))))((((...)))).....((.((((....)))).)))))))).))).))))....((((.(((((((...(((((((((((....(((....((..((..((.(((.....))).))))..))...)))....)))))))).))).....)))))).).))))(((.((((((((((..((........)).(((((((......))))))).....)))))...))))).)))))))))...)))))..(((((((((.............(((((...)))))...)))))))))((((((.....(((((((...(((...)))...)))))))))))))(((((((((((((((((((......))))))).((((((((((((((..((.(..(((.((((((........(((((...(..(((((.........))))).)...))))))))))).)))..)))..)...(((((((((.(((((((....(((((((((...)))))))))....)))))))(((........)))((((........))))))))))))).......(((((((....(((((((....(((......)))))))))).)))))))....))))))))))))).............(((((.((...(((((.(((........))).))))))))))))))))))))).)))(((.((((.((.((((((....(((((....))))).....)))))).)).)).)).)))........))))))).))))(((........))).(((((((((.(.((((((((......))...(((((((....)).)))))..((((.((((((....((((.((......)).(((((((....(((...((......))..))).))))))).....((((...(((((..((.(((((.(((((((....(((((.((((...)))).)))))..)).)))))))))).)).))))).))))))))...)))))).)))).........))).)))).))))))..)))..
Thermodynamic Ensemble Prediction
..,{{{,((((.{(((((((((((({...........(((({,{(((({({{{{{(((((((((.,.((((((((,((,.,...((({(.(((({..(((....))).........,((((((((((.(((({(((.((((,(....,,}.)))).))).)))...)).)))).)))))){{{|||{}||{,}...,)))))),)}))}}}},})||||..}))))..,.,},}}}}|},}|{{{{{{{,,|||,,,}.{||||,||.((((.(((((((...(((((((((((.,..(((....((..((..((,(((....,))}.))))..))...)))...,))))))))},)).....)))))).).)))){||.|||||{{{{(,,|{.....,,..|,(((((((......))))))).}...)}})),,.})))),))).((((({...,......|)))))),...}},,..}.}))||||,,.)))))))}))(((((.(((((((,....{((((((...(((...)))...)))))))))))))).))))),((,.(((((((......))))))).,||((((((,((((.(((.(((((((,,..}}}..}}}}}}|,||}}.}}}|||,,{{{{,.{,.,||||{|...|||{{({||||.{.,...{{{{{...,(((((,,(((((((((.,..(((((((((...)))))))))..,.))))))},}).{{{{..{{{.((((...,....||||}}}}}},,),,,....||{{|||,.}}|,,||||....((({,...,|||,,|||||.,,)))))..}})|||,|}||||||{{,....,}}}}}|||{|.{,|},{((((.(((.{....,}))).))))))))))))))),,))))},,},}},,}}}}}}}((((((....(((((....))))).....)))))),||{{|,|||))),.{{{{...{{{....,,,,|||..}},,{,{||.,|{|.||||,,,}}|))|,,}|.}}}}}...|||||}|},,,)).))))),.|,,{.{{{({(||||((((,{{,.{{{,|,.|||||||},.,{{{..{(|,..,.|||{|{|||||||,,..,,|}{{||,,.{{|||,,((.(((((.(((((((....(((((.((((...)))).)))))..))}}})))))))).)).}}))}.}))))})}.,,)))))).,,}|{{.......}|||}}}}.}}}}}})}}}},.

Transcripts

ID Sequence Length GC content
AGUUUGCUUGGAGCUCCUGGGGCCUAACAAAAAGAAACCUGCCAUGCUG… 1283 nt 0.5838
Summary

The protein encoded by this gene is part of the innate immune response, protecting the lungs against inhaled microorganisms and chemicals. The encoded protein may also be involved in surfactant metabolism. [provided by RefSeq, Jul 2015]

Forensic Context

A study in humans demonstrated that the lung marker SFTPD exhibited high human specificity in organ tissue identification assays, with only sporadic false positive signals observed in some animal organ RNAs [van den Berge & Sijen DOI:10.1002/elps.201700241]. The review of forensic transcriptomics notes that SFTPD is an mRNA marker for lung identification, as mentioned in the context of tissue identification studies [Lei et al. DOI:10.1093/gpbjnl/qzag007]. A study in human forensic autopsy cases demonstrated that the SFTPD mRNA expression was significantly lower in lung specimens from drowning, mechanical asphyxiation, fire fatality, and acute cardiac deaths compared to those from fatal hypothermia and injury [Miyazato et al. DOI:10.1007/S00414-012-0698-2].