| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUCACCCGGCAGACUCCGGAGGGUAGAGCGCUGUGCCGGUUCCGCUGCC… | 3336 nt | 0.4059 |
Sphingosine-1-phosphate (S1P) is a bioactive sphingolipid metabolite that regulates diverse biologic processes. SGPP1 catalyzes the degradation of S1P via salvage and recycling of sphingosine into long-chain ceramides (Mandala et al., 2000 [PubMed 10859351]; Le Stunff et al., 2007 [PubMed 17895250]).[supplied by OMIM, Jun 2009]
A study in human bone demonstrated that the protein OSTP_HUMAN showed a clear visual and significant negative trend with increasing postmortem interval, as identified through a multi-omics integration model for PMI estimation [Bonicelli et al. DOI:10.7554/eLife.83658]. A study in mice demonstrated that the monocyte/macrophage-associated gene SPP1 was significantly upregulated in myocardial tissues following acute myocardial infarction, as validated by qRT-PCR in an AMI mouse model [Yang et al. DOI:10.2147/JIR.S516092].