| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUUCUUCCUCCCUGGGGAUGGAUCCAAGCUAUUGUCCUGCCCAUGGCU… | 2127 nt | 0.6822 |
The protein encoded by this gene is expressed in B lymphocytes and contains pleckstrin homology and src homology 2 (SH2) domains. In Burkitt's lymphoma cell lines, it is tyrosine-phosphorylated in response to B cell receptor stimulation. Because it binds Shc independent of stimulation and Grb2 after stimulation, it appears to play a role in signal transduction from the receptor to the Shc/Grb2 pathway. [provided by RefSeq, Jun 2009]
No relevant information is available at the moment.