| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUCGUCUCCCGGCAGUGCAGCUGCCGCUACCGCCGCCCUCUGCCCGCCG… | 751 nt | 0.5912 |
Involved in cytoskeleton organization. Located in cytosol; nuclear body; and ruffle membrane. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans demonstrated that the SH3BGRL3 is a highly expressed transcript in platelets isolated from patients with acute myocardial infarction [Eicher et al. DOI:10.3109/09537104.2015.1083543]. In a separate human study analyzing subcutaneous adipose tissue, the SH3BGRL3 was identified as part of a 38-gene obesity signature, with a positive coefficient of 0.0457, and the overall signature correlated strongly with body mass index and fat mass, indicating its expression alterations are associated with environment and lifestyle rather than genetic background [Font-Clos et al. DOI:10.1088/1361-6579/aab85a].