| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGACAGCGAGAGCGAGAGAGCGAGAAGGGUGGCAGAGGAGGCGCGGA… | 9636 nt | 0.6623 |
This gene encodes a member of the SHANK (SH3 domain and ankyrin repeat containing) family of proteins. Members of this family act as scaffold proteins that are required for the development and function of neuronal synapses. Deletions in this gene may be associated with autism spectrum disorder in males. [provided by RefSeq, Apr 2016]
A study in mice demonstrated that the SHANK1 gene, a protein-coding gene, was identified as a differentially wired (DW) gene enriched in synapse part annotation within the prefrontal cortex of selectively bred lines with differential risk for voluntary methamphetamine intake [Hitzemann et al. DOI:10.3390/brainsci9070155].