Basic Information

Symbol
SHANK3
RNA class
mRNA
Alias
SH3 And Multiple Ankyrin Repeat Domains 3 PSAP2 KIAA1650 SPANK-2 Prosap2 SH3 And Multiple Ankyrin Repeat Domains Protein 3 Proline Rich Synapse Associated Protein 2 Shank3 Postsynaptic Density Protein Proline-Rich Synapse-Associated Protein 2 Shank Postsynaptic Density Protein DEL22q13.3 PROSAP2 ProSAP2 SCZD15 Shank3
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_001372044.2
Sequence length
7691.0 nt
GC content
0.6801

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3632.50 kcal/mol
Thermodynamic ensemble
Free energy: -3750.35 kcal/mol
Frequency: 0.0000
Diversity: 2089.57
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.......(..((((((((........)))...)))))..)......((((((.((.(((((...(.((((((((((....))))....((((((..(((..(((.(((((....(((((..((....)).((.(((..((..((((..(((((((((...((((((.((((...(((....)))..)))).......(((((........)))))..............((((((...((...(((((((((.((((((..((((..(((.(((((...((((((....(((((((((((((.(.(((((.........((.(((..(((((....)))))..))).))(((.(.((((((((((((((((.(..((((((((((...(((((((.((((((((((((((((((((.(((((.((((..((((((..((((((.(((....((((((((((((((...((((((((((.(.(((.(........).))))))).)))))))..)))))))))))))))))))))))..((((((((((.((......((((((((.((((((.((((.(.((((((((.((.(.......).)).)))))))).).)))).)))))).))))))))....((((.((.((.((((.(.....).))))))..))..))))..((.(((((((..(((.((((((((((.(((((((.((((((..........(((((((....(((((....)))))......(((((((((((((((((((...)))).....)))))..)))).))))))...(((((.((.....((......))....)).)))))....)))))))..........)).)))).((((((.....((......))....)))))).((((((................)))))).((((....))))(((((...)))))(((((((.((.(...((((((((((.(((((.((((..((((..((((........))))...))))...(((((.(((.((((((.(..((..((((.((((.(((.((.((((((((((((.....)))).))).....))))).)).))).))))..((((((....(((.(((((.((.(((...))).)).))).)))))..))))))(((....))).........)))).))..).))))))))).))))).........((((((((((....((((((((..............))))))))(((...)))...)))))).))))((((((((.(.(((..(((.(.(((......))).))))..))))))).))))).)))).))))).)))))))))))))..)))))))....))))))).)))))))...))))))..))))))).))...)).)))).)))))).........(((((((((.((..((((((.....(((((((.(.((....)).).))))))).))))))....)).))))))..))).............)))))).)))).)).))).....))))))))......((((((...(.((((.....)))))...))).)))(((((......))))).(((.....)))......)))..)))))))))..)))).)))....))))))))))..)...))))))))....).)))))))).))).......))))).).))))))....((((...(((.(((((((....((((.((.....((((.(...(((((((((...)))))))))...).)))).....)))))).(((....))).))))))))))........))))......(((((..(((((((.....((.......))))).(((((.((((.((((..(((.....))).)))))))).))))))))))))))(((((..((......))...)))))..))))))).(((((....((((((....))).))))))))..(((((.((..(((.....)))..)).))))).)))))).....))))).))).)))).))))).).))).)))))))))))))).))))))..)))))).)))....))))..)).((((..((((((...))))))...))))))).))..(((((..((...))...)).)))..))))).....))))).)))..)).)..))))))......(((((.(((((...(((((((((..(((..(((((.((((((((.(((.(((((....))))).))).)))((((((......)))))).....((((((((.(((((.((((....)))))))))))))).)))(((((((.(((.....((...((((.........))))..)).....)))...)))))))((((((((((((((((((((....)))))))))(.(((((((((((((((...)))).....(((((...(((((((..((((((.........(((((((((((((........((((((...))))))........((..(((((((((((...((..(((((....((..(((((((......))))))).))((((.......))))..(((((...........((((.((((...(((...)))....)))).).)))..(((.(((...(((......))).))).)))..)))))........)))))..))(((((((........)))))))......)))))))))))..)).))))))))))))).((((((((.(((.......((((.((.......)).)))).....)).).)))))))).....(((((.((.(.(((.....((((((((((((((((((....))))))..)))((((((...)))))).(((((((.........((((((..((((.((..(((((....(((((..((.(((((.((((........)))))))))))))))).....)))))...))))))...))))))))))))).((((((((((........(((...(((((((....))))))).)))..((((((((.(((((((((((((........))))))............)))))))..)).)))).))..))))))))))((((((((.........((((((.((.((((.(((((..(((((((.......)))))))..((.((((((((((.((..(.((((.((.(((((((...)))))))((((((......))).)))..(((.((((((....((.(((.(((.......)))))).)).))))))..))).((..((((..((.(((((....((((..((((.((((..((..(((.(......).)))..)).)))).).))).))))..))))).))..))))..)))).)))).)..))))))))))))))...))))).)))).)))))))).)))))))))))))))))))).).)))))))..)))))))))))))(((((((((...((((......)))))))))))))(((((((((((((((((.((((((((((.((((..(((((.((....((((((((.((.(.((.(((((((((..((((((..(((.((((((......((((((.(((((...)))))((((.....)))).....))))))...)))))).)))))))))....)))))..))))))).)).)))))))).....(((((((.((....((((.((......)).))))..)).)))))))..((((.(((((.((..(((((...((..................))..)))))..)).)))))))))..)).)))))...)))).))))).))))).))))))))))).....((((.((((((((.(((((((...((((((((((((((((..(((..(((((((...(((..((((((.(.(.(.((((((((((((((.......))))))).((..(((((((((((....((((((...(((...)))....((.(((((.((....)).))))).))..((((((((..((((.((((...........((((.....))))((((..(((.((((((.((((........(((((((....(((((((((((((((.((((((((((((....((((.((.((((.((.(((((.(((((((((....((.(((((((((...))))).))..)))))))))))).).))))).))(((((.(((((.....))))))))))...)))))).)))).))))))))..((((((....))))))...(((..((((((.(((.((.(((.((((....)))).))).)).)))..))))).)..))).....)).)).)))))))))))...))))((.((.((((((((.....)))))))).)).))((((((((.(((.(((...(((((((((((((.(..(((.......((((.((((....((((......))))....))))))))...)))..).))))))).))....))))..(((((((((((.......))))).(((((.(.((((.(((.(....))))))))..).)))))((((((((((............)))))).))))..............((((((((.((...((.((((...(((((...........(((.((...)).)))....((((((.....))))))....)))))..))))..)))).))))))))(((((...))))))))))).))))))))))))))..))))))).......))))..)))).))))).))))(((((.((.(((....(((((((.....)))).)))...))).)).)))))...))))))))((((((((((...))).))))...)))....)))))))))))))))))))))))))..))..))))))).).)).))))))..((((....))))((((...))))((((..((((((.(((((...((.(((((((((((((((((.(((....(.(((.((.(((((((((.((((((......))).((((.((....((((.(..(((((((((((((((.((..((.((.((((((......)))))).)).))..))..((((((((((((.(.(((((((.(((....(((((((..(((((((((((((...)))))).((((.((.(((....))).(((((.(((.(((((.(.((((((((((((((((((((((((.(.((((((((.(((.((......)).)))..)))))))).)...)))...))).))))))))))))).))))).).))).....)).))).)))))(((((((((.(((....)))))))).))))........))))))))))))).))))))).)))...))))))).)))))).)))))))(((((((.(((.(.((((((.((..((....))..))))))))...).))).))))))).....))))))))))..((.....)))))))..))))).))))))..((((((.(((.(((((((((((........)))))(((((((((..(((((((((..((((((((((((((((.(((((...(((.(((...))).)))...))))).))(((((.....)))))..((((((((((((.((((((((((((((..((((((....))))))((((((((((..((((((((.((((((((((..((((.........)))).))))))(((((..(((.....)))..)))))....)))).)))))).((((.((.(((......(((..(((((......)).)))..))).....))).))..)))).))..))).))))....))).)))))))))))))).....)))))))))))).....)))))))((((...............))))....(((((((...)))))))....))))))).)))))))))........)))))))))...((((((.((((((((((((((((((....(((((((((......)))))).((((((.....((((..((((.........))))..))))...))))))...)))...)))).)))).)))))))))))))))))))))).)))...))))))....)))))))))))).)).))).))))..)))).....((....))..((((.....))))))))))))((((.(((.(((..(((((((((..(((((((((.((....)))))))))))..)).)))))))..)))..)))))))....))))).)).........))))).))))))..)))).))).)))))))..)))..))))....)))))))....))))).....(((((((((....)))..)))))))))))))..))).)))))))))..((......)).)))))).((((...)))).......((((((((((((((.(((((((.((((......))))..)))).))).....)))).)))).))))))))))).))))))))))).).)))))))))))))))))))))..))).((((......))))))))))))).))))))))))........((((((((......)))))))).)))))).)))))))).))))))((((((((...))))))))((((((((((..(((((((((.(((((.((..((((...)))).)).))).)).......((((((((((((..((((......))))((.(((..((((.((((........((((..((((((((((.((((..(((((((((((((((.(((((...)))))))))..)))))))((((.......)))).....))))..)))).)))))))))).....))))........)))).))))))).)).....)))))...)))))))...((((((((..........(((((((.(((....)))..)))))))))))))))((((((...........))))))(..(((((.((......)))))))..)...............((((((((.....(((...((((((((......))))))))...)))))))))))))))))))).((((((((..(((...((((((..(.(((.((.......))...)))).)))))).))).))))))))(((((.(((..(((((...........(((((.(.(((((((.........((((((.........)))))).............(((.....))).))))).)).).)))))...........)))))............((((((((....((((((.((((........)))).......((((((((...)))))))).........))))))...))))))))))).))))).))))))))))..........((((((((((...(((((((((((((((..........)))))))).)))))))...))))))))))...
Thermodynamic Ensemble Prediction
.......({{..((((((,.,,(,,,{({,{,..||||.......,{,{{({.({.,,,||..,||{||,,,(|((,.|,}||||{,|{{{((((({({.,((((((((({{,{((({{..(({,{{{{{,{{{{.{{(((((({(.,(,.....,,...,,,{((((({{(.((((((..(((((((((,(((,((((((({,,({((,(((((..,.{{......{{((((((...{{,,.((((((((({,(((((..((((..(((.(((((...((((((....(((((((,,{{((.,.{{,((,..,.....{{.(((..(((((....)))))..))).||(((.(.(({({((((((((((,.({.(({({(((({{{{((((,(({((((((((({(({((((((({((((({((,({{(((((({{((((((((({((,.,((((..(((((((({(((((,(((((((...|))))..}}.))))),,))).))))))}..))))|||||||||{((((((({(,{,,,,{{{|.||}}}},..,}}}))))).))}}))))))))))))},}}))))))))))})).}|||,|||||((,.(((((({(((,{.({(((({((({{.,{(,..{{({.{|||.}}..}))}}|}}}||,{||,,}|||,||||,,.{|.|||||||},{{{({{{,,|}||,,}}||||.,,..,.,.)}}|||}||})))||||.,,,,})|||,.....|(({((((({{{{||||{|,,.,)))..,,,))}))..)))).)))))),,.|||||.|{....|,{{,...})).,..,,{|||||,({{{{{(({{,.{,,,,...,|,((({.,....|}}}..{,...,.|}},,.}}..,(({{..|||..,(((({......|||},..|||{,.,,,|))},,{{{{...||{(((.(((...(((((..((((((((((.(((((.((((..{(((,,((((........)))).,.))))...(((((.(((.((((((.(..((..((((.((((.(((.((.((((((((((((.....)))).))).....))))).)).))).))))..{(((((....(((.(((((.((.(((...))).)).))).)))))..)))))}{((....))}.........)))).))..).))))))))).)))))......}|.((((((((((..{,(((((({(..,,.,,,....,,))))))})|||...})},,.)))))).))))((((((((.(.(((..(((.{.(((......))}.})))..)))}))).))))).)))).))))).))))))))))..,.))))).))).))))}}}}{|||}|{({{{{{|||||{{{{{{((((((.{{{{..||,,|((({.......)))}||,,.}}}),))}|||......,,||||{||,}})}})}}))}}}))}},,)})))))))...}}|||.||||.{{..........)}..)))),)}))))}))})),......})))))),,,,{{((((((...(.((((.....))))}...))).)))|||{|},....}}},,.(((....,))}.},...)))..)))))))))..||||{|||{,..}|||}|||||{{|{{.}|}}||||||{{|,|||}||}},|||.......,|||,.|{||||||{...{{(({{,({,((({,{||,..}|,||}|,...}}||||}}}..|||{|||||...})))))))),..),))}}.....})},},.|)))}}})))})))||||}||..,....,}|||,,,...,,,||,.||||||||,,...........||||..{{|||,{|||,|||{.,|||.,.,,))},)))))))),})}))})},}}}))||{,,.,||...,,.))..,))))),.))))))).{((((....((((((....)))}}))))))}..(((((.((..(((.....)))..)).))))).)))))).....))))).))).)))).))))).).))).)))))),,,))))).))((({{.,(({{{,|||..,|(((..,{((((.,.((((((.(((((((((..((((((..(((..(((...(((......)))....)))..)))...))))))..)).))))..))).))))))...)))).}}.|||.((((((((((.(({..{.,{{.{{,{..{((((.(((.(((((....))))).))).)))||((((......))))},...|,||((((((((((({,({{{,,.,))))))))))}))).}}}...))))))))))))),,.}}||{,.,}}}}}}}))})}))).}..})))).,}.))})).})|))})))))))||.,))))))).)))))).))))))).|,,,,{,{{...)})))}..)))))},..(((((((..((((((.........(((((((((((((..,{{.,.((((((...)))))).}...,}}|(,{(((((((((((...((..(((((....((..(((((((......))))))).))((((,....}.))))..(((((.......,..((((..,((,{((((({.{{{,.{{.,,))})).))..}}}}.((((....)))).,)...)))),,)..)))))........)))))..))(((((((.,....,.)))))))......))))))))))),.)).))))))))))))),((((((((.(((.......((((.((.......)).)))).....)),}.)))))))).}....((((((...}))))).,.({{((({{((({{((({{..,,}})))),.}))((((((...)))))).(((((((.,,....,,{(({((..((((.((.,((({(,.,,{{{{|}.{(.(((({.{{{{......,,))))))))))}))})),....)))}}..})})))),..))))))))))))),((((((((((.........,,...(((((({.,,.)))}}}}.,}|,|(((((({{.(((((((((((((........)))))|,....,,.....)))))))..)).)))),)),.}|||}||}||((((((((,,.,...{.((((((.((.((((.(((((..(((((((.......)))))))..((.((((((((((.((..{.((((.({.(((((((...)))))))((((({......))).)))..(((.((((((.{...({({(.(((.,....}))))))),).))))))..))).((..((((..((.(((((....((({{{{{{{.||||,.({.,(((,({,.,|...,})..)},)))).).))).)),}..))))).))..))))..)))).)))).}..))))))))))))))...))))).)))).)))))))),})))))))))))))}}}}}},},,,))}},..}))}}}}}}))))|||{{{||{.||||||,.,},,,}.,)))))))))|{,(({(((((((((((.((((((((((.((((..(((((.,(((((((((((..(((.(((((((((((((({.(.{,,,..,.|.}})))),,....(((((((((({,...(((((((........{{((,..,|,.,,,.(((((.......))))),...,)))))}(((((......)))))))))).)).}||)))))))))..})))),)})))))..))))))))))).,.{{...((({,(((((.((..(((((,,.,,..................))..)))))..)).)))))))))..})})))))...)))).)))))}}}))).))))))))))),|{{{(((({,{,({,{,((((((,{...,,,(((((((((((((..(((..(((((((...(((..((((((.(.(.(.((((((((((((((.......))))))).((,.{((((((((((,...{(((((...({,...|)).,,,((.(((((.({....)).))))).))..((((((((.,((((.((((...,...,,{,((((.....}}}}({((..({{.{{{(((.((({...,,...(((((((....(((((((((((((((.((((((((((((....((((.((.((((.((.(((((.(((((((((....((.(((((((((...))))).))..)))))))))))).).))))).))(((((.(((((.....))))))))))...)))))).)))).))))))))..((((((....)))))),..(({,{((((((.(((.((.((,.((((....)))).,)).)).)))..))))).}}})))..,,.)}.)).)))))))))))...))))((.((.((((((((,...,)))))))).)).))((((((((.({{,(((...(((((((((((((,,.,(({....,,,(({({((((....((((......))))....))))))))...)))..).))))))).}|,||.||}|{.((((({(((((.......))))).|||||}|.||,||(((.|....})))))})..),)))))((((((((((............)))))).)))).,,,,...,.....((((((((.((.,.({.((((...(((((...........{{{.{{,..}}.)))....((((((.....))))))....)))))..))))..}))).)))))))){{{{{,,,))))}}))))).))))))))))))))..))))))).}.....))))..)))).))))).}}}}(((((.((.(((....(((((((.....)))).)))...))).)).)))))...))))))))((((((((((...)))}})))...)))..,.)))))))))))))))))))))))))..}),.))))))).}.)).))))))..((((....))))((((...))))((((..((((((.(((((...((.({{(((((((((((((({((,.{{,(.(((.((.(((((((({,((((((......))).((((,((....((((.{..(((((((((((((((,({..((.((.(((({(,.....,}}))).)),)}..))..((((((((((((.(.(((((((.,(,{{.{(((((((..(((((((((((((...)))))).(((({({.(((....}}}.{{{{{.|||,||(((.(.((((((((((((((((((((((((.(.((((((((.,(({(({.....}}})))..)))))))).)...)))...))).))))))))))))).))))).).)))....,|},|}|,|||}}{{{((((((.((,...})))))))),.))).},.,,,,)}})}}))))))).))))))),),)}..))))))).)))))).)))))))(((((((.(((,,.((((((.((..((....))..))))))))...).))).)))))))..,,.))))))))))..{{.....)))))))..,)))).}))))){.((((((,(((.(((((((((((........)))))(((((((((.,(((((((((..(((((((,{((({{{{,||((({,{(((.(({...,}|,|}},|,|||}|,||(((((.....)))))}.((((((((((((,((((((((((((((...(((((,,((||{||({,{({.,,((,..,,,|||,.|,|||{..|}}}}))|,.......,||||,}}|||{{((,(((({{(((.{,...{((({(...((....)).))).))}..,...)))))))).)}..}.)))}....,})}}}}{{{((((..({.{{.....)),.))..)))),)))..})))).)))))))))))))).,...)))))))))))).,..,)))))}},,{{.........,.....))))},,.{((((((...))))))}....))))))).))))))))).......,)))))))))...((((((.(((((((((((((((((({{{{(,,((((((......)))))).{{{...,..........{{{{.........)))).}))))...|||,,,....}}...)))).)))).)))))))))))))))))))))).})),,.)))))),...)))))))))))).)).))).))}}|||,)),,...||....}}..((((.....))))))))))))||{,((((.(((..(((((((((..(((((((((.((....)))))))))))..)).)))))))..)))..))))}}}....}})))}},.......,.))))).))))))..)))).))).)))))))..)))..))))....)))))))))..}.)))}}},},,{||||||}}}.)))}}))}}))))))))}||||||||}}},}}||,||,}.,,,}||||{.{{{{{{{....(((.....}}|{,|||||||||||.{{,((({.{{{{......))))..}}}}.})),|,}.}))),))))})}}}||||,},.,,}}},,,,))}}})}}}},...}})))}))),},..}|)}||||}.}||,)},,({({{||{|{|{(((({({{{(...{(((.{(((({....(((((((...(((.((((.(((((((((((({.((((((((...))))))))(((((((({.{{(.{({{{||||,|||.|||.((({...,,)).,},})}))).,,,}}}||((((((((({..((((......))))((,{{{..{(((.((((.....,,,((((..((((((((((.{(((..((((((((((({(((.(((((...))))))))}..}))))))((((.......)))).....))))..)))).))))))))))..,..}}})........)))).))))))).}}.....}|}}},,.}})))}|{{.{((((((((..,{{{,..,,|||||.(((....)))..)))))))))))))))||||||..,,......,))))))}}.(((((.((......)))))))})))))...,.....|||(((((({,...,{(((...((((((((......))))))))...)))))))))))}}},...,......,((((..((((((......,))))).))))))))))).)))).))).))))))).....,||||,.,,({((.....,,}}}}........}}}}.}})}.))))},,,.,.,..((((((.........)))))).....}}}})).})))}))}).,..,.{{|{||{..,|||..,,...,....}||||....,||....(((((((((....((((((.,,,,....,..{||||.......{(((((((...))))))))}}}}}....))))))...))))))))).{||,},}..))),))))))).,......((((((((((...((((((({(((((((,(,,...,},)))))))).)))))))...)))))))))),..

Transcripts

ID Sequence Length GC content
ACACACCGCACUGGAGGCUCCGCUCUGCCCGCUCCGGGACCCCUUCCUC… 7691 nt 0.6801
Summary

This gene is a member of the Shank gene family. Shank proteins are multidomain scaffold proteins of the postsynaptic density that connect neurotransmitter receptors, ion channels, and other membrane proteins to the actin cytoskeleton and G-protein-coupled signaling pathways. Shank proteins also play a role in synapse formation and dendritic spine maturation. Mutations in this gene are a cause of autism spectrum disorder (ASD), which is characterized by impairments in social interaction and communication, and restricted behavioral patterns and interests. Mutations in this gene also cause schizophrenia type 15, and are a major causative factor in the neurological symptoms of 22q13.3 deletion syndrome, which is also known as Phelan-McDermid syndrome. Additional isoforms have been described for this gene but they have not yet been experimentally verified. [provided by RefSeq, Mar 2012]

Forensic Context

No relevant information is available at the moment.