Basic Information

Symbol
SHH
RNA class
mRNA
Alias
Sonic Hedgehog Signaling Molecule MCOPCB5 SMMCI TPTPS HHG1 TPT Shh Unprocessed N-Terminal Signaling And C-Terminal Autoprocessing Domains SHH Signaling Molecule Sonic Hedgehog Protein ShhNC HLP3 HPE3 Sonic Hedgehog (Drosophila) Homolog Sonic Hedgehog Homolog EC 3.1.-.- HHG-1
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_000193.4
Sequence length
4650.0 nt
GC content
0.5432

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1777.80 kcal/mol
Thermodynamic ensemble
Free energy: -1860.98 kcal/mol
Frequency: 0.0000
Diversity: 865.89
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((((((((..(((.(((.............(((.((((.(((((((...((((((((((........(((.(((((..(((((....(((((.((((...)))).((((.((((......)))).))))((((.(((...))).)))).)))))....)))..)).))))).))).........))))))))))...))))))).)))).))).(((((.(((((((((((((.(((...((((........))))...............(((.((((....)))).))).)))..(((((((((((.((((...((((....(((..((((......))))..)))...))))))))..))).)))))))).)))))))).))))).)))))((((..(((.(((.....(((((((((((.(((.....((.......))......))))))))))..))))....))))))..))))....(((((((((.((.((((.((((((.((((...(((....(((..((..(((..(((.((.....)))))..)))..))..)))....)))...))(..((((.........))))..)...(((((..(((......)))...........))))).......((((...(((((((((((.((.(((.....))))))))))).))))).)))))).)))).)).))))))..........(((((.(((((.....((((((((((.......(((((((((.((((((........)))).)).)))...(((((.......)).)))))))))(((.(((((((((.....((((.((((.(........).))))..)))).....))))))))).)))....)))))).))))))))).)))))..((((((((...)))))))).))))))))))))))))))))))((((((((((..((((..(.(((((((((...((((((....((((((((((((((((.....((((((((((.(((((...(((...(((..........))).))).....((((((((.(((((((((..........)))))(((((.((((((.(((((.....)))))..)).)).)).))))).)))).))))))))....(((.(((((((((((.(((((((((((...))))))))))...(((.((....)).)))((((((.((((.(((((((....(((.....))).)))))))))))..)).)))).).))))))))))))))...)))).).)))))).)))).))))))))).)))).)))....((((((((((((((((((((((((((..(.((((....)))))..)))).((((((((.......((((((.((((((((............((.((((((.(((.((((.((.((((((((((((((((...(((...)))..((((.((((.(((((.(((...(((((.(((.......))))))))..)))..))))).)))).))))((((((.((((((((((((.(......).))))....)))))))).)))))))))))))))))))....))))).))))))).......(((.(((.(((.....)))))).))))))))).))..))))))))..))))))(((((((.((.....)).))))))).(((((.(((((...((((((((((((.((((.(((((((((((((((.((....))...)).............((((((....((........))...))))))...........................(((((((..((((((((((((...(((((((.((((..(((((((((......(((((......).))))........))))))))).)))).)))))))....((((((.((((((((((......((((........(((((((........(((((......)))))..))))))).......))))...(((((.((((((...)))))).)))))........((((.......)))))))))))))).)).........))))((((...)))).))))))))))))...)).))))))))))))))(((.......)))....)))).)))))))...)))))))))...))))).))))).((..((((((..........))))))..))(((.(((((....((((....))))....(((.(((((.((((.....((((....)))).......)))).))))).)))....(((((((((((((...........))))))))))))).......((((......(((((((...(((((....((((((..(((((...((((.......))))..)))))..((..(((.((((((...)))))).)))..)).................................................................))))))...)).))).)))))))....))))....((((..(((((.....)))))..)))).............)))..)).)))..)))))))).))))))(((((((.....(((((((.....)))))))......)))))))((((((....(((((((..((((.(((((((........)))))))))))..(((((((....)))))))((((...)))).(((..((((((........))))))..)))...)))))))....)))))).........))))))))))))))))...(((((((((.((((.(((...(((((((((....))).)))))).((((((.(((((..(((((.((((((....((...)).((((.((........)).))))((((((((........)))))))).)))).)).)))))..))))).)))))).((((((((..(((((((((...)))))))))......(.((((((......)))))))(((((((((((((((((.((((...((((((((((..((((((....(((((((.......)))))))..(((((..(.(.((((...)))).).).)))))))))))..))..(((((((..((((((...((((.(((.(((...(((((.((.(((.....)))(((((((((((..(......)..)))..))))))))(((((((((((((((((...(((((.(.......).)))))....)))))))))).)))))))))))))).))).))).)))).....)))).))...)))))))((....))))))))))..)))))))))))....(((((.((....)).))))).(((....)))))).))).))))...............))))))))..))).)))).))))))))))))))).))))))))))..))))..))))))))))..)))))).....(((((((((((.(((((((....)))))))......(.((((.....))))).....(((((((((((.(((((((.....))))))).))...)))))))))((((((..((.((((((((......((.((((((((((.......((((....))))))))).)))))))....(((((((((.(((((...((((..(((((((((.......((((......))))((((((((((..((((....)))).)))))))))).((((..((((((((..(((.(((((((.(((.(((..(((..(((((.(.((((.(((......))))))).).)))))))))))..)))...))).)))).)))....(((((.....))))).((((((((((((..(((.((((((((.((....(((((....((((((((...((((((((..(((..((.((...((.((((((...(((..(.((((((...)))))).)...)))....)))))).)).)).))..)))..))))))))...))))))))..)))))...))))))).....))).)))..))))))))))))...(((.........)))(((((((((((.((..(((.(.(((....)))).))).)).)))))))))))))))))))...))))((((.....)))))))))))))((.((.....)).)).(((((((((((((((((.........))))))))))).))))))....))))))))).)))))))))......(((.....)))((((....))))....((((((((........))))))))..((..(((((((.....)))))))..))(((((.....))))).))))))))..))..))))))(((.(((.(..(((.....)))..).))).)))((.((((((((((...(((((((((((.(((((....))))).))....((((...................))))....)))))).))).)))))...))))).)).((((((...((........)).....)))))).....)))))))))))
Thermodynamic Ensemble Prediction
....((((((....((((((.........{{{{((((.......)}}|,,|}}}}((((((((((.......{(((.{((((.,(((((....(((((.((({...}))).{(((.((((......)))).)))}((((.((,...}}),)))).)))))})}))))..,}.))))}.))).}.......)))))))))).)))))),,,)))))}{{{,(((((.(((((((((((((.(((...((((........))))....{,......,{|(((,((((.,,|)))).}|}.|||,.{{({(((((((.{(({,{,(,{(..|,||{..{{{|.,.,,,}))},,))),}.)}))))))},))).)))))))),)))))))).))))).)))))(((.((((..(((((((((((.{(((((,,,(((,,(.((((((,{(({{.......(((((...(((((..(((((((.....{((,....((((((,...{((((((((.(,{((((,,(((((((.(((((...(((((((....{((((((((.....((({,,.((((((,.........({..............)){(((((....({{..(((.(.((..(((((.((..((((((((.((((...((((..,({(((((((((,{{.(((.....)))})))))))))}))}.))))(((((.(((.((((((((((((((...(((((.(((((..,,,{{{(((((((.......{(({(((({.(((({{....,,,.}}}},,}}))).},,(((({.{{...)).)))))))}|(((.(((((((((....,{(((.((((.(........).)))).,))}).....))))))))).))),...))))))}.)))))))).)))))...(((((((...)))))))(((((((((.((((((.((({{,({(((.(((((((..(.((((({,(((..,{.((((.((((.(((((((({((((((((.....((((((((((.(((({...(((...(((..........))).)))...{.((((((((.(((((((({,.....,...}))))(((((.(({(((,(((({.....}))))..))),),)).))))).)))).)))))))),...(((.(((((((((((.(((((((((((...))))))))))...(((.((....)).)))(((({{.((((.(((((((....(((.....))).)))))))))))..)).)))).).))))))))))))))...)))).).)))))).)))).))))))))}.)))).))).}.)))}.......{.(((((.((((((....}})))}},,.))))),.))))..,.))))))))).)..))))))).))).(((((.{.((,...,)).}.))))).}))))).))))))))))..(((((((((((.((((((.(.((((.((((.(((((.(((.,.(((((.(((.......)))))))),.)))..))))).)))).))))((((((.((((((((,,(,,(,.....,.)))}....)))))))).))))))((,((((((,(((,..(,((,..,|}.,,))}.)))))},}|((.(((.....})))),{|||{{{{{|||||,||,.,||||}||,}},||,||||.{{|}..,,,.)))))),.}.,}})}}}).)))))))))))))))))(((((((({{{,(((..((.......))..)))...,,........((((((....((........))...))))))............{((((((((((((((((((((((((((({(....(((((.,(((((.(({........},,)}.))))).}.)))))....,,,...............,)))))..))))))))))))),}))))))))})}}))))))).{{({{(((((,,{{,,,,.}}}}}}}}|||{{......}}}}},,|},}}.,..,,..)))))...(((((.((((({...}))))).)))))..,..,.,((((.......})))|{{((((((((.((((((.((((........))).).))))))..)))))))).....,))}))))))))))(((......)))..)))).))))))))........)))).)))))},))..)))))))..)).)...)))....))}))))))))))))........{(((,,,,||||....(({.(((((.((((.,...((((....)))).....,.)))).))))).}))....,{{{{{{(({{{{.....,.....)))))))))))}}.......,},},},((((.....,.}})}.....|||,|{,...(((((...((((.......))))..)))))...}},}}|.....(((((((((((((({,........,,,............................................{(({.(((((((((.{(((((((.(,({{.,((((,,,,|}}},|,..,{{{..{,{{{,||}})))})}))))).....((({{...))).)}.(((((......))).)).}.)))))))}.))))))))).))))(((((....)))))........((((((....(((((((..{(((.(((((((........))))))))))}..,{{{{{|....}))}}}|((((...))))}(((..((((((........))))))..)))...)))))))....)))))).,))))))))))))))})))))))}...(((((((((.((((.(((...(((((((((....))).)))))).((((((.(((((..(((((.((((((....{{...}}.((((.((........)).))))((((((((........)))))))).)))).)).)))))..))))).)))))).((((((((..(((((((({...}))))))))......{.((((((......))))))},((((((((((((((((.((({..{(((((((({{..((((((....(((((((.......)))))))..(((((..,.{.((((...)))).}.,.)))))))))))..}}..(((((((..((((((...((((.(((.(((...(((((.(({{((.....))}(((((((((((..(......)..)))..))))))))|((((((((((((((((...(((({.,.,......,))))),...))))))))))},))))))))))))).))).))).)))).....)))).))...))))))),,....},)))))))),})))))))))))....(((((.{(....)).))))).(((....)))))).))).)))|,...........,,.))))))))..))).)))).))))))))))))))))...))))).))))))),.))))))))))).))))))))))...)))...))))..)))..)))))...)))))((((((((.((,(({{{{{.,|||||,((((..(((.....))}..)))).,{{{{,.(({{((((((,.,((.((((.(((((((((((.((((.{(.(((.(({{,{...,)).}).))))),))))..))).)))))))).)))).)})))))))))).,))))}}}.|||||,.....,,}}},}))))))))))((((((((((..((({....}))).)))))))))).((((..((((((((..(((.(((((((.(((.(({,,(((..(((((.(.((((.(((......))))))).).)))))))))}),.)}}..,))).)))).)))....(((({.....})))).((((((((((((..(((.(((((((,,((.,,,(((((....((((((((...((((((((..(((..(((((((((({(((((({,.,,,..,.{(((({...})))))})))))}.}}}.)))))),}}.}.,}}..)))..))))))))...))))))))..))))).,,)}))))).....))).)))..))))))))))))...(((.........)))(((((((((((.((..(((.(.(((....)))).))).)).)))))))))))))))))))...))))(((((((....,)))).)))}))),})).)))))))))|((((((((((((((((.........))))))))))).)))))),,.,))))))))))))((((((({..(((((.........,{{{....}}},....((((((((........))))))))..((..(((((((.....)))))))..)))))))}))))))))))..))))}))}|,({{{{...(((.(((.(..(((.....)))..).))).))).,|{{,.((((((....(((((,{,((.(((((....))))).)).,))}},}....)))))),}}..))}}){|{,.((({{,...,..})))..,}))..,,,,..((((((((.(({.{{{({.....}}),,,)))...))))))))}})..

Transcripts

ID Sequence Length GC content
ACAAGCUCUCCAGGCUUGCUACCAUUUAAAAUCAGACUCUUUUUGUCUU… 4650 nt 0.5432
AGACACGCUCUCCCCGCGCGGGCCUAGGUGCCAGGCGAGGGUGCUGGCG… 828 nt 0.5809
Summary

This gene encodes a protein that is instrumental in patterning the early embryo. It has been implicated as the key inductive signal in patterning of the ventral neural tube, the anterior-posterior limb axis, and the ventral somites. Of three human proteins showing sequence and functional similarity to the sonic hedgehog protein of Drosophila, this protein is the most similar. The protein is made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the developing embryo. Defects in this protein or in its signalling pathway are a cause of holoprosencephaly (HPE), a disorder in which the developing forebrain fails to correctly separate into right and left hemispheres. HPE is manifested by facial deformities. It is also thought that mutations in this gene or in its signalling pathway may be responsible for VACTERL syndrome, which is characterized by vertebral defects, anal atresia, tracheoesophageal fistula with esophageal atresia, radial and renal dysplasia, cardiac anomalies, and limb abnormalities. Additionally, mutations in a long range enhancer located approximately 1 megabase upstream of this gene disrupt limb patterning and can result in preaxial polydactyly. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice and human RWPE-1 cells demonstrated that cadmium exposure induces prostatic fibrosis by elevating the SHH level, which activates the SHH signaling pathway, promotes epithelial-mesenchymal transition, and increases collagen deposition [Huang et al. DOI:10.1002/Jat.4436].