| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGUAACUCUUGAGCUGGCUCAGGGAGCGCACUUCCUUCUCAGCCAGC… | 2401 nt | 0.4136 | |
| GAGGACGCGCGAAACGGCGGCGGCGGCGGCGGCCAGGGGGGAGCCGGGG… | 2110 nt | 0.4218 |
This gene encodes a protein that is a member of the seven in absentia homolog (SIAH) family. The protein is an E3 ligase and is involved in ubiquitination and proteasome-mediated degradation of specific proteins. The activity of this ubiquitin ligase has been implicated in the development of certain forms of Parkinson's disease, the regulation of the cellular response to hypoxia and induction of apoptosis. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that chronic methamphetamine administration significantly dysregulates the SIAH1 in microglia, which is involved in the ubiquitin-mediated proteolysis pathway [Oladapo et al. DOI:10.3390/Ijms26020649]. Another study in mice showed that adolescent exposure to MDMA induces comprehensive transcriptional changes in the cerebral cortex, where the SIAH1 is upregulated as part of the altered Wnt signaling pathway [Eun et al. DOI:10.1016/J.Taap.2009.02.027].