| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCACUCACUGUGGAUUUAGGGGAGAUAUUAUGAGGCUGUUGUCAUUAGG… | 2713 nt | 0.5415 |
This gene encodes a member of the sine oculis homeobox transcription factor family. The encoded protein plays a role in eye development. Mutations in this gene have been associated with holoprosencephaly type 2. [provided by RefSeq, Oct 2009]
A study in humans demonstrated that the SIX3 was identified as a high-confidence gene in common between mice and humans within the top 10% of genes related to lifetime alcohol consumption through transcriptional network analysis of postmortem prefrontal cortex [Farris et al. DOI:10.1038/Mp.2014.159].