Basic Information

Symbol
SKAP2
RNA class
mRNA
Alias
Src Kinase Associated Phosphoprotein 2 SKAP-HOM SKAP55R RA70 SAPS SCAP2 Src-Associated Adapter Protein With PH And SH3 Domains Src Kinase-Associated Phosphoprotein 2 Src Family-Associated Phosphoprotein 2 Retinoic Acid-Induced Protein 70 Pyk2/RAFTK-Associated Protein SKAP55 Homolog SKAP-55HOM PRAP Src Kinase-Associated Phosphoprotein Of 55-Related Protein Src Kinase-Associated Phosphoprotein 55-Related Protein Fyn-Associated Phosphoprotein SKAP55 Homologue Src Family Associated Phosphoprotein 2
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference Individual identification

MANE select

Transcript ID
NM_003930.5
Sequence length
3839.0 nt
GC content
0.3777

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-943.60 kcal/mol
Thermodynamic ensemble
Free energy: -1016.01 kcal/mol
Frequency: 0.0000
Diversity: 1084.95
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.........((((.(((....(((.((((.(((.((.((((((((((((((............))))..))))...))))))..)).))).))))..)))...(((((((.(((((((((((((((((((................))))))))........(((.........)))....(((((.((((((...((((...))))....))))...((((((.(((((((....))))))))))))).......)).)))))........(((...........))).....((((.(((........(((((((..((((.....))))...))))))).))).))))..)).)))))))))......)))))))....................(((((((((.((((.....(((((((..(.(((........)))....)..))))))).....))))..)).)))))))...)))))))(((((.(((((.((..(((((......)))))..))))((((((((((..(((((...((..(((...((.((((((((((.(((((......((((.((((..((((((....((((.(((.(((((((....)))))))))).........(((((((((..(((((.((((((((((((((((((((.((.....)).)))......(.((((((((...(((((.(((((((((((((.(((((((((((........))))))....((((.(((...((((..............))))...))).))))(((((((...(((....((((((((...(((((((((((((((((..(((((..((((((..(((((((....))).))))..))))))........((.............))......(((((.(((...((((((((((((..((..(((((((.......(((......)))(((((.(((((.............(((((((..((((...)))).((((((.(((((((((((((((..(((((((.((.........((((........((((..(((((.((....((((((((((((((((((..((.(.(((((((..((((.((((..((((..................((.((((((((((((((.....(((.((((......)))).)))....((........))((((((...)))))).....((((.....))))...)))))))))))))).))...))))..)))).)))).))))))).)..))..))))))))))))............(((((....)))))...........(((((((........)))))))..(((((..((((((.((((((.....))))...)).)))))))))))...)))))).))..)))))..))))...))))((((......))))))..)))))))..)))))))))..)))...)))...))))))...)))))))(((((.(((((.(((((.....)).)))))))).)))))...))))).))))).))))))).))..))))))).)))))...)))))))).)))))...)))))))).)))))))))...)))))))))))...)))))))....((((((((..(((.(((((((((((..........((((((((.........(((((........)))))..........((((((......))))))..............(((((((....))))))).))))))))...................((((((..((((((....))))))..)))))).......((((((((..(((((....((((...)))).....))))).......))))))))......((((((((......((((.......((((((((..........))))))))............((((((.................))))))..)))).......)))))))).(((.(((...))).))).)))))))))))..)))...)))))))).((((((...(((((.(..(...(((((....)))))...)..).))))).))))))....((((.(((..(((((((.(((......).))))))))))))..))))(((((((((((((.(((((....((((....................((((((.....).)))))...(((((.((((((.....(((......)))....)))))).)))))(((((((((((.((((.((((......))))......((..(((((((((.((((((.((((.((............)).))))...)))))).)))))))))..))..(((((.....)))))...)).))))))....)))))))....)))).....))))).))))))))..)))))))))))))))).))))).))..)))))..)))))))).)..........(((.(((((((...))))))).))))))))...))))))).........(((.(((((.((((((....)).))))))))).)))((((((.............(((((..((((((..((((((((.(((((((((((.(..............).))))))))))).........))))))))...))))))..))))).............))))))..((((((....))))))..(((((.((((.((......))..)))).)))))..((((((((..((((..((((((.................))))))..)).))))))))))(((((....))))).......(((.((.(((((.......))))).)))))..))))))))))...)))))))))..(((...(((((...(((((((((((..(((((((((((.(((((((((.........((.((((....(((..(((..(((((...)))))..(((....)))......(((((((......)))))))...((.((((((...((((((((((((..(((((...((((.(((((..(((....((((.....)))).((((.......)))).)))))))).))))..))))).........)))))))))))).)))))).))...(((....(((((((..(((((..............))))).)))))))...))).(((((........))))))))..)))...)))))).(((((((.((.(((((.........))))).)).)))))))(((((...((.((((.(((((...........))))).)))).))........(((..(((((.((.((.......(((......))).........)).)).)))))..)))....(((.(((.(((.((..((((...))))..)).))).))).)))(((((((..............................))))))).)))))...............................((((((..(((((........))))).)))))).((((....(((((((..(((........))).....)))))))....)))).))))))))).)).)))))))))...)))).)))))))....))))).....))).....))))...))))))....)))).))))))))))))))))))).))...)))))...)))))...))))))))))................))))))))..
Thermodynamic Ensemble Prediction
........,{(((((((,...(((.((((.(((.((.((((((((((((((.,|.........))))..)))}.,.})))))..)).))).))))..))),..(({{{({,(((((((((((((((((((.,............}.))))))))........(((.........}}},,,.(((((.((((((...((((...))))....))))...(((((,{(((((((....))))))))))))).......)}.))))).....,,.(((...........))}...,.{{{{.{{{||......(((((((..((((.....)))).,.))))))),)),.}}}}..}}.))))))))).,....)})))))..,.....,.,,,.......(((((({{({(({{.....{((((((..{.(((........)))....}..))))))}.....}}},.,))))))))))...,,,...|||||||||,((.{{..{{{{{......}}))),,))),((((((((((..(((((...((..(((...{{.(((((((({{{(((((......((((.((((..((((((....((({,((({(,,,,||}}},|||||,|||,,,,......(((((((((,.{((({{((((((((((((((((({((.{(.....}}.}}|......{.((((((((...(((((.{((((({((((((.(((((((((((........))))))..,.{{{((((,{{{,((({{{,.{{{......||||,{{|||.||{|{{{((((.,.(((....((((((((...(((((((((((((((((.,(((((..((((((..(((((((....)))},)))..))))))........,,.............}}.,....(((((.(((...((((((((((((..((..(((((((.,,,{{{(({..,.{{{{{({{,..,,({|,...,,...,{{{({,,{{((((,,{,,({(((,{{,,.{{{..|||||,|..{{|{,},,,,.}}))..,}}},.|||}},..,}))),,,,,)})))),,)})))))){(((((((.(((({({{({{,(((((((({{((,,.,(((({.(((,,,{{{{((((((.((((((({,((({{((((((...,..((((((,,..(((((....,,..}}))),,{{{...,..,||||}..,,,,,.{((((((((.....))))...))))),{{{{||||{}}|.{{(((((.......)))))))|||,..,),},)))))},.))))))..,.)))))}{((((,,..,,|||{{{..{{{{{{{((((((........)))))),.,((({..,,,.{({{,,,.,,}.}},,}}.}}}))}))))).)))))}..,.}}}}.}}}|))},,..}}})))).)))))).}))))))).))))}.,}}}}}}}........}}}}}},}}})},,,},)))},.}}))))))|||||..,....,,,,...,|||}.},},,((((((((({...))))),})))}))))))).))..))))))).)))))...)))))))).))))}.,.)))))))).)))))))))...))))))))}}|,|.}}}}}}}}}}}}|||||,,.,||..|||||||{|||.})}}..,..{(((((((,,.......{{{{|,,,..,,,|||,,....,..,..((((((......))))))............,,{{{{({{....})))))).)))))))}...................((((((..((((((....))))))..))))))...{{.{(((({(((,,((((({{{{((((...)))}.....|||||.......,}}))))){{{.,{((((((((,...,{(((({{{....((((((((........,.))))))))..,,,....}},....{{..,((((({{....,{{||||||.......,,,...|||||||}..,,|((,,..|||{{||,||||||,,.....,|{{{.,,,)))),.{{({{|...(({{({{|,{,..{{|||,..,))}})||..|.}.}}}}),}}}}}}.}}}||||}|.||}{((((((.(((......).))))))))}},)},))))||||,,{{||{((,((,{{..|,|||,....................((((({.....}.)))))...{((((.((((((.....{((......})}....)))))).)))))|||||||||,,.,,,,.((((......))))....,.((..(((((((((.((((((.((((.((............}),))))...)))))).)))))))))..))}}|||||}..,,||||....))}))))))}}}},},,)))}}))))),,}}..)))))}))))))))}),))))))))))))))).}))))}},..}}}}}..)))))))).}.....,,...(((.(((((((...))))))).))))))))...))))))}...,{..,{({,....,|}||||,{,|||||,|,.,|||||{||,{,{{,{.......,..,,.(((((..((((((..((((((((.(((((((((((.{..............}.))))))))))).........))))))))...))))))..))))}..,,,,.....,{||||||{{{((((({{{..}}}||..(((((.((((.{(......}}..)))).)))))..{(((((((.,({((..((((((.................))))))..)).)))))))))}}}}}}}}.})))))}}}}}}}||{.{(.(((((.......))))).)}}}}.})))))))))),},}}))))))}..,,....,((((.,,(((((((((((..{(((((((((({{{(((({,({,{{{,,.,{{{,{{{...}|{|.,|||}}.||{.,,,})},|,.(((....)))....{,(((((((......)))))))..,|{.{{((((...((((((((((((.{((({{,..((((.(((((..(((....((((.....)))).{{{(,......,})).)))))))).))))..}}}}},,,.,,}}.)))))))))))).))))||,|}...{||,,..(((((((..(((((.,,,....,,,...))))).)))))))...))).{((((........))))),}}.,}}},..}}}|||,{{{{{{{.{{,,,,(({{{{{{{{.,,,))}))})))),,,{,((({{.((.((((.(((((...........))))).)))),))}}},....(({..(((((.{{.{{.,,....(((......))).........}}.}}.)))))..))).}}.(((.{((.(({.((..((((...})))..)).})).))).)))(((((({...,,.......,,,,,.............)}}}})).}}||,.,.....,....,|,,...............((((((..(((((........))))).))))))}}}},,,,.})))})}{(((((((({.((((((......)))))).},))))))))).,,,,.,},}))))))))...)))).))))))).,,.))))},)))}),)}}}},)))),,,))))))....)))).))))))))))))))))))).}}...)))))...)))))...)))))))))).......,.......,})))))))..

Transcripts

ID Sequence Length GC content
AUUUGUCUAGUGAGGGCUCUGCCCCAGACCCGGCUCUCCAUGCUCACUG… 3884 nt 0.3756
GACUUCCUUGUUGUGAGCCCCGGCCCGGCAGUGUCCCGACUCGUAGCCC… 3839 nt 0.3777
Summary

The protein encoded by this gene shares homology with Src kinase-associated phosphoprotein 1, and is a substrate of Src family kinases. It is an adaptor protein that is thought to play an essential role in the Src signaling pathway, and in regulating proper activation of the immune system. This protein contains an amino terminal coiled-coil domain for self-dimerization, a plecskstrin homology (PH) domain required for interactions with lipids at the membrane, and a Src homology (SH3) domain at the carboxy terminus. Some reports indicate that this protein inhibits actin polymerization through interactions with actin assembly factors, and might negatively regulate the invasiveness of tumors by modulating actin assembly. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]

Forensic Context

A study in zebrafish and mouse demonstrated that the SKAP2 transcript, a lens development protein, increased in abundance within 1 hour postmortem in mouse brain and liver tissues [Pozhitkov et al. DOI:10.1098/rsob.160267]. A study in humans established a method for detecting Single Amino Acid Polymorphisms (SAPs) in hair shaft protein within an East Asian population, though inference of the corresponding non-synonymous single nucleotide polymorphism might be incorrect [Fan et al. DOI:10.1016/j.fsigen.2024.103158].