| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUUGUCUAGUGAGGGCUCUGCCCCAGACCCGGCUCUCCAUGCUCACUG… | 3884 nt | 0.3756 | |
| GACUUCCUUGUUGUGAGCCCCGGCCCGGCAGUGUCCCGACUCGUAGCCC… | 3839 nt | 0.3777 |
The protein encoded by this gene shares homology with Src kinase-associated phosphoprotein 1, and is a substrate of Src family kinases. It is an adaptor protein that is thought to play an essential role in the Src signaling pathway, and in regulating proper activation of the immune system. This protein contains an amino terminal coiled-coil domain for self-dimerization, a plecskstrin homology (PH) domain required for interactions with lipids at the membrane, and a Src homology (SH3) domain at the carboxy terminus. Some reports indicate that this protein inhibits actin polymerization through interactions with actin assembly factors, and might negatively regulate the invasiveness of tumors by modulating actin assembly. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
A study in zebrafish and mouse demonstrated that the SKAP2 transcript, a lens development protein, increased in abundance within 1 hour postmortem in mouse brain and liver tissues [Pozhitkov et al. DOI:10.1098/rsob.160267]. A study in humans established a method for detecting Single Amino Acid Polymorphisms (SAPs) in hair shaft protein within an East Asian population, though inference of the corresponding non-synonymous single nucleotide polymorphism might be incorrect [Fan et al. DOI:10.1016/j.fsigen.2024.103158].