Basic Information

Symbol
SKIC2
RNA class
mRNA
Alias
SKI2 Subunit Of Superkiller Complex DDX13 SKI2W HLP SKIV2L1 SKIV2L SKIV2 170A SKI2 SKI2 Homolog, Superkiller Viralicidic Activity 2-Like Superkiller Complex Protein 2 Ski2 Like RNA Helicase Helicase-Like Protein Superkiller Viralicidic Activity 2 (S. Cerevisiae Homolog)-Like Superkiller Viralicidic Activity 2-Like (S. Cerevisiae) SKI2 Subunit Of Superkiller Complex Protein Superkiller Viralicidic Activity 2-Like Helicase SKI2W EC 3.6.4.13 EC 3.6.1 THES2 Ski2 W
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_006929.5
Sequence length
3795.0 nt
GC content
0.5831

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1563.00 kcal/mol
Thermodynamic ensemble
Free energy: -1629.81 kcal/mol
Frequency: 0.0000
Diversity: 744.92
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((((.((((((....(((((....((((.....)))).....))))).....))))))))..(((((((((((......))))))).....))))(((((((.(((((((..(((((.(((((((((..(((((....((((((.((((((((.((((((((...((((((((..(((.(((((((.....))))))))))(((((((..(((((((.(((((((......(((.((.....)))))......))))))).(((.((.....((((((...((((.((((...((.(((...(((......))).....)))))...)))).))))....))))))(((((((((((((((.(((((...((((((((.......)))).))))....))))).))))......((.(((((...))))).)).(((((.......)))))......))))))))))))).))))))))))))))))).(((.......)))..))))))))..)))).)))))))))))).)).))))....)))))....((((((((((..((((((.((((((..........(((((((((................)))).(((((((.(((((((..((..((((...(((((((((((((((....((((((..((((..((((.((((....(((((((((.((((((..((((((((((.((((.((((.((((((..............)))))).)))))))).((((((.....))))))....(((........)))..(((((((((((((.........))).(((((.(..((.(((......)))))..))))))....)))))))))).)))))).....))))...)))))).)))))))))..(((...(((((((.(((((((.....(((..(((((((((.(.....((((((((((((..((....(((.((((.........))))..)))....))..)))))))......((.(((((.......))))).))..)))))).)))))))))......................(((((((((.(((.((((........)))).))).)))(((((.....))))).)))).)))))))))))).))(((((((....))))))).)))))...))))))).))))..))))..))))))...)))))).)).))))))))))).....))..))))))).)))))))(((((((((.(((((((.....)).)))))(((........))).(((((...(((((.((((.(((((((((((...(((((.(((((((..(((......)))................(((((((.((((....)))).))..)))))...))))))).)))))(((.....)))..((((.((.....))...))))...((((((....(((((....)))))...))))))(((((.((((........((((((((.((((....(((((((((((((........)))....((((.(.((((((((((.....((((((..((((((................((((((......)))).))....(((((((((..(.(((((..(((...)))..))))).).....)))))))))((((.((((.((......)).))))))))))))))..)))))).(((((((((......))).)))))).))))))..((((..((((.((((.((((((((......)))).....(((((.((((((((((((......)))).(((.....)))(((..((.(((((((...((((((.....((((((((.((((((...((.((((((.(((..((......))((((((((((...(((....)))....)))).)))))).((((((((.((((((.(((.(((((((((((((.((((((..((((((((((.(((((((((..(((......)))..)))))).)))))))).)))))......((((((..((((((...(((.(.((((((((.((((.(((...(.((((((.((((((((..((.(((((((.......))))).)).)).)))))))).)).((((.((((((..((.((.(((.((.(((.((.(((....(((((.....))))).....))).))..))).)).))))).))..)))).)).)))).......)))).)))).)))))))))))).).)))...))..)))).)))))))))))).)..........)))).....))))))))..))).)))))).))))))))...)))...)))))).)).......))))))))))))))...((((....))))))))))...........))))))).))..)))..(((.((((((.((((.(.((.((((((..((.....))..).))).)).)))))))..)))))).)))))))))))))))))))).)))).)..)))))))...)))).)))))(((((....))))).))).)))))))...)))).)))))))).........))))))))).))))))))))))))).))))).)))))...(((.((((.(((.((....))...))).)))).)))))))))))).(((((((...(((((((((((.(((..((((....(((((((...))))))).))))))).)))))...))))))...))).))))....)))))))))))))))))..))))))))))))))..))))))))))...)))))))(((((((((.....(.(((((((((.(((((.((....)).)))))..)))..((.(..(((((((.(((((((((.(((.(.((((((((((((((((((...))).......(((((((((......))..)))))))))))))))...(..((((((((.((....(((((((((((((((.((((((((((((((.(((((((((...((((((.(((.((((......))))(((((..((.(((((((.((((.....((((....)))))))).))))...))).))..))))).((((((.((((......)))).)))))).(((((.(((...(((.(..........).))))))))))).....)))))))))))))).)))))))))(((((((...((((((......)))).)).))))))).........))))))))).))))(((((((....))...)))))((.((((((((((((((....)))).)))..))))).)).)))))))))))))......((((.....))))........)).))))))))..)(((((.....)))))))))))).).)))..)).))))))).)))))))..).))........)))))).))))))))))(((((((((.....((((((((((((((((.((((..(((((...((.....)).)))))(((((((....))))))))))).).))))))))(((((((((.....))))).))))(((.(((.....))).)))..(((((((((((((..((((...((((....(((...)))...))))))))..))))))).)))))).))).))))...)))))))))......))))))).......(((((....)))))........))))))..
Thermodynamic Ensemble Prediction
...((((((((.((((((....(((((....((({.....}))).....))))).....))))))))..{,,,(((((((......))))))),{{{.|||{(((((((.(((((((..((((,{(((((((((,.(((((....((((((.(((((((({((((((((...((((((((..{{.{(((((((.....))))))))}}(((((((..(((((((.(((((((......(((.((.....)))))......))))))).{({.((....{((((((...((((.((((.,.((.(((...(((......))).....)))))...)))).))))....))))))|((((((((((((((.(((((...((((((((.......)))).))))....))))).))))......((.(((((...))))).)).{((((.......)))))......))))))))))}}}.))))))))))))))))),,{{.......},,..))))))))..)))).)))))))))))).)).))))....)))))....{(((((((((,.(((((,{((((((..........({{{{((((,||,,..,...,,,..}}}}.(((((((.(((((((..{({.((((...(((((((((((((((....((((((..((((..((((.((((..{.(((((((((.((((((..(((((.(((..((((.((((.((((((...,,.........)))))).)))))))).((((((.....))))))...,{,.....,,,.{((..(((((((((({((.........}}}.(((((((..(,{(((......)))))..))))))....))))))))))..))),,))).)))))...)))))).)))))))))..(((...(((((({.((((((,.....({{..(((((((((.{.....(((({(((((((..((....(((.((((.........))))..)))....))..)))))))......((.(((((.......))))).))..)))))}.))))))))).....,|..,..,,.......||{|,,..,|||((.((((........)))).))).}}|(((((.....)))))))}}}})})))))))))).}}(((((((....)))))))})))))...))))))).))))..))))..))))))...)))))).)).))))))))))).}}..))..))))))).))))))){((((((({{(((((((,....)).}))))}{{.,,.,,..,|{{(((((...(((((.((((.(((((((((((...(((((.(((((((..,({......})},.|.....,,......(((((((.((((....)))).))..)))))...))))))).)))))(((.....)))..((((.{,.....,,...))))...{(((((....((({,....})))}...)))))|((({({((((,{,{,,,.{{{(((((.((((....((((((((((.,{...{{{..((((((..(((.(..(.((((((({.{{.(((,((..{(.((......}|,|,.,{{{{(({((({..,,,||||.{......|||}}}|,,}}},,{||.}|,}}},),)).})),))).)).))))))))).,|))).|.))))))..}}),.,}}|||({,|,|||,,,,||||{(({(((({({{{{{{,|,{||||,,.)))))}..{{{(..{({,,((((.((((((((......)))).....(((((.(((((((({({(,.....,))}.(((.....)))(((..((.(((((((...((((((.....((((((((.((((((...((.((((((.(((.,((......))((((((((((...(((....)))....)))).)))))).{(((((((.((((((.{((.((((((((((((..{{((((..((((((((((((((((((((..(((......)))..)))))),}))))))).)))))......((((((..(((({{.,.(((.(.((((((((.((((.(((.,.,((({((({,,(((((({{((.(((((((.......))))).)).),.}}))))))}))..{||}}.{{((,,{(.({.(({.((.(((,({.(({{{..(((((.....))))).}},}))),))..))}.)).))))).))..)}}}.,},,||,..,|||}))}),,))),)))))))))))).).))).}.}}..)))).))))))}))))).},,....,...)))}....,))))))))..))}.)))))).))))))))...}))...)))))).)).......))))))))))))))...((((....))))))))))...........))))))).))..)))..(((.((((((.((((.(,{(.(((({{..{,.....}),.},))).)}.}})))))..)))))).)))))))))))))))))))).)))).}..)))))))))))))).))).,|||||,.,.})))}.))).)))))))...)))).))))))))..,,}....)))))))))}))))))))))))))).))))).))))),).(((.((((.(((.((....))...))).)))).)))))))))))).(((((((...(((((((((((.(((..((((.,..(((((((...))))))),))))))).)))))...})))))...))).))))...,))))})))))))))))).,))))))))))))))..))))))))))...)))))))(((((((({.,..,..{{((((((,.(((((.((....}}.}}})}.{|}|.,|{,||}{((((((.(((((((((.(((.(,(((((((((({(({{,(({{{{{{...}}}((((((((,,......}}..)))))))))))))}|(({{{,((((((((.((..,.((((((((((({(((,((((((((((({((,(((((((((...((((((((((.((((......))))(((((,{((.(((((((.((((....,((((....)))))))).))))...))).),},))))).((((((.((((......)))).)))))).(((((.(((...(((.(..,.......).))))))))))).....)))))))))))))).))))))))}(((((((...{{((((......)))).}).))))))).......,,))))))))).))))((({(((.,{,||...||}}}{,.||{((({((({{{(....)))).)))},})))},)).,,)))))))))))}.....((((.....))))........)).)))))))),.))}|.,,.}}..))).))))))).),)))..}).))))))).))))))),.)})),..,}}.,))))))}})))))))))(((((((((.,{,,{,{{((((((((((((.((((..(((((...((.....)).)))))(((((((....))))))))))).).)))))))){((((((((.....)))))}}))}(((.(((.....))).))).,(((((((((((((..((((...((((..,.(({...})),..))))))))..))))))).)))))).},,}}})}...)))))))))......)))))),...}))}|,|||,...,}}},........))))))..

Transcripts

ID Sequence Length GC content
AGCUGCUGUGGCUCCAGGAUGAUGGAGACAGAGCGACUUGUGCUACCCC… 3795 nt 0.5831
Summary

DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a human homologue of yeast SKI2 and may be involved in antiviral activity by blocking translation of poly(A) deficient mRNAs. This gene is located in the class III region of the major histocompatibility complex. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the SKIC2 was upregulated in the ileum of methamphetamine-treated animals compared to controls, as identified through RNA sequencing and validated by qPCR, and its gene locus is located near SNPs associated with inflammatory bowel disease [Sun et al. DOI:10.21037/Atm-20-7741].