| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCUGCUGUGGCUCCAGGAUGAUGGAGACAGAGCGACUUGUGCUACCCC… | 3795 nt | 0.5831 |
DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a human homologue of yeast SKI2 and may be involved in antiviral activity by blocking translation of poly(A) deficient mRNAs. This gene is located in the class III region of the major histocompatibility complex. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the SKIC2 was upregulated in the ileum of methamphetamine-treated animals compared to controls, as identified through RNA sequencing and validated by qPCR, and its gene locus is located near SNPs associated with inflammatory bowel disease [Sun et al. DOI:10.21037/Atm-20-7741].