| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAUCCCGGAGCCGGCGCAGAUGAGGCAGUUCGGCUGGGGCCAGCGGCGC… | 6081 nt | 0.3906 |
Involved in cytoplasmic microtubule organization; microtubule nucleation; and positive regulation of microtubule polymerization. Located in centrosome; cytosol; and microtubule plus-end. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans identified the SLAIN2 as an mRNA marker for age estimation, demonstrating its expression decreases with age in dried blood stain RNA-Seq data [Dørum et al. DOI:10.1016/j.fsigen.2023.102976]. This marker was part of a lasso regression-selected gene list that achieved a mean absolute error of 4.46 years for age prediction in the primary dataset, establishing its utility in a forensic mRNA assay for predicting a biological stain donor's chronological age.