Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACACUUACUUGCACCAGUGCCCAGAGAGGGGGUGCAGGCUGAGGAGCUG… | 3608 nt | 0.5942 |
Summary
This gene is a member of the solute carrier family 11 (proton-coupled divalent metal ion transporters) family and encodes a multi-pass membrane protein. The protein functions as a divalent transition metal (iron and manganese) transporter involved in iron metabolism and host resistance to certain pathogens. Mutations in this gene have been associated with susceptibility to infectious diseases such as tuberculosis and leprosy, and inflammatory diseases such as rheumatoid arthritis and Crohn disease. Alternatively spliced variants that encode different protein isoforms have been described but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
Forensic Context
A study in humans using an integrative machine learning approach on multi-level molecular data from monozygotic twin pairs identified the SLC11A1 gene as having higher methylation at a CpG site in heavier twins with less leisure time physical activity [Kibble et al. DOI:10.1098/rsos.200872]. In a separate human study analyzing temporal gene expression in thermally injured skin, the SLC11A1 gene was found to be significantly up-regulated in burned tissue compared to normal skin [Greco et al. DOI:10.1016/j.burns.2009.06.211]. A study in mice demonstrated that the SLC11A1 gene was upregulated in blood leukocytes as part of a common early transcriptional response across three models of systemic inflammation and injury (trauma/hemorrhage, burn, and LPS infusion) [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005]. This upregulation was identified via microarray analysis and validated by RT-PCR, indicating its role in the immune response pathway following injury.