| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCCUGAAGCUGACAGCAUUCGGGCCGAGAUGUCUCGCUCCGUGGCCU… | 943 nt | 0.3913 |
This gene encodes a serum protein found in association with the major histocompatibility complex (MHC) class I heavy chain on the surface of nearly all nucleated cells. The protein has a predominantly beta-pleated sheet structure that can form amyloid fibrils in some pathological conditions. The encoded antimicrobial protein displays antibacterial activity in amniotic fluid. A mutation in this gene has been shown to result in hypercatabolic hypoproteinemia.[provided by RefSeq, Aug 2014] CIViC Summary for B2M Gene
A study in humans demonstrated that the B2M exhibited the highest relative expression across saliva, blood, menstrual blood, and vaginal secretion stains and was among the highest in semen, showing consistent high expression across individual donors and successful detection in small and environmentally exposed stains, establishing it as an effective reference for assessing human mRNA quantity in forensic body fluid analysis [Moreno et al. DOI:10.1111/j.1556-4029.2012.02086.x]. Subsequent research in humans quantified the degradation state of the B2M transcript in dried bloodstains via ΔCq, finding its degradation rate accelerated 5-10 fold at 37°C versus 20°C and was similarly influenced by relative humidity, with ongoing investigations to incorporate these environmental effects into forensic sample age estimation [Heneghan et al. DOI:10.1016/j.fsigen.2020.102456]. A study in mice demonstrated that the B2M (B2M) is a suitable endogenous control gene for normalizing gene expression analysis after experimental traumatic brain injury, as its expression remained stable in contused brain tissue at 24 hours post-injury (+26%, not significant) and exhibited low interindividual variation (±10-40%) [Thal et al. DOI:10.1089/neu.2007.0497].