| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCGGGGGUGCGGGGCUGUGACCUAGAGGCUUCAGUGUCGAUCCCCGA… | 10757 nt | 0.3977 |
SLC16A10 is a member of a family of plasma membrane amino acid transporters that mediate the Na(+)-independent transport of aromatic amino acids across the plasma membrane.[supplied by OMIM, Apr 2004]
A study in humans demonstrated that the SLC16A10 is an mRNA marker down-regulated with increasing age in blood, identified via microarray and validated by TaqMan qPCR [Zubakov et al. DOI:10.1016/J.Fsigen.2016.05.014]. This biomarker was included among nine mRNA biomarkers used in an age prediction model combining RNA and other biomarkers for donor age estimation [Haas et al. DOI:10.1016/j.fsigen.2021.102486].